ID: 1142668707

View in Genome Browser
Species Human (GRCh38)
Location 17:1477495-1477517
Sequence CACACTTCCTGACGTGAGTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668707_1142668717 28 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668717 17:1477546-1477568 CTCCAGGAAGGTCAGGTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 332
1142668707_1142668712 12 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668707_1142668713 16 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668707_1142668716 21 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668716 17:1477539-1477561 CCAGCTTCTCCAGGAAGGTCAGG 0: 1
1: 0
2: 0
3: 48
4: 545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668707 Original CRISPR CACACTTCCTGACGTGAGTG GGG (reversed) Exonic