ID: 1142668710

View in Genome Browser
Species Human (GRCh38)
Location 17:1477497-1477519
Sequence TCCACACTTCCTGACGTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668710_1142668713 14 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668710_1142668716 19 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668716 17:1477539-1477561 CCAGCTTCTCCAGGAAGGTCAGG 0: 1
1: 0
2: 0
3: 48
4: 545
1142668710_1142668717 26 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668717 17:1477546-1477568 CTCCAGGAAGGTCAGGTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 332
1142668710_1142668712 10 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668710 Original CRISPR TCCACACTTCCTGACGTGAG TGG (reversed) Exonic