ID: 1142668711

View in Genome Browser
Species Human (GRCh38)
Location 17:1477500-1477522
Sequence CTCACGTCAGGAAGTGTGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668698_1142668711 5 Left 1142668698 17:1477472-1477494 CCTTGCCCCCAGCAGCCCCGCAG 0: 1
1: 0
2: 8
3: 64
4: 692
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668700_1142668711 -1 Left 1142668700 17:1477478-1477500 CCCCAGCAGCCCCGCAGCCCCAC 0: 1
1: 0
2: 6
3: 89
4: 733
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668699_1142668711 0 Left 1142668699 17:1477477-1477499 CCCCCAGCAGCCCCGCAGCCCCA 0: 1
1: 2
2: 11
3: 101
4: 833
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668703_1142668711 -10 Left 1142668703 17:1477487-1477509 CCCCGCAGCCCCACTCACGTCAG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668702_1142668711 -3 Left 1142668702 17:1477480-1477502 CCAGCAGCCCCGCAGCCCCACTC 0: 1
1: 1
2: 19
3: 121
4: 736
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668697_1142668711 6 Left 1142668697 17:1477471-1477493 CCCTTGCCCCCAGCAGCCCCGCA 0: 1
1: 0
2: 5
3: 30
4: 404
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668696_1142668711 29 Left 1142668696 17:1477448-1477470 CCGCAGGCTCTGCTGCAAGTGAG 0: 1
1: 0
2: 1
3: 29
4: 295
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668701_1142668711 -2 Left 1142668701 17:1477479-1477501 CCCAGCAGCCCCGCAGCCCCACT 0: 1
1: 0
2: 4
3: 82
4: 446
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668711 Original CRISPR CTCACGTCAGGAAGTGTGGA TGG Exonic