ID: 1142668712

View in Genome Browser
Species Human (GRCh38)
Location 17:1477530-1477552
Sequence CAGTATCCTCCAGCTTCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 251}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668710_1142668712 10 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668699_1142668712 30 Left 1142668699 17:1477477-1477499 CCCCCAGCAGCCCCGCAGCCCCA 0: 1
1: 2
2: 11
3: 101
4: 833
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668700_1142668712 29 Left 1142668700 17:1477478-1477500 CCCCAGCAGCCCCGCAGCCCCAC 0: 1
1: 0
2: 6
3: 89
4: 733
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668704_1142668712 19 Left 1142668704 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668706_1142668712 18 Left 1142668706 17:1477489-1477511 CCGCAGCCCCACTCACGTCAGGA 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668707_1142668712 12 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668703_1142668712 20 Left 1142668703 17:1477487-1477509 CCCCGCAGCCCCACTCACGTCAG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668708_1142668712 11 Left 1142668708 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668701_1142668712 28 Left 1142668701 17:1477479-1477501 CCCAGCAGCCCCGCAGCCCCACT 0: 1
1: 0
2: 4
3: 82
4: 446
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668702_1142668712 27 Left 1142668702 17:1477480-1477502 CCAGCAGCCCCGCAGCCCCACTC 0: 1
1: 1
2: 19
3: 121
4: 736
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668712 Original CRISPR CAGTATCCTCCAGCTTCTCC AGG Exonic