ID: 1142668713

View in Genome Browser
Species Human (GRCh38)
Location 17:1477534-1477556
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 283}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668703_1142668713 24 Left 1142668703 17:1477487-1477509 CCCCGCAGCCCCACTCACGTCAG 0: 1
1: 0
2: 0
3: 9
4: 171
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668706_1142668713 22 Left 1142668706 17:1477489-1477511 CCGCAGCCCCACTCACGTCAGGA 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668708_1142668713 15 Left 1142668708 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668707_1142668713 16 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668704_1142668713 23 Left 1142668704 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283
1142668710_1142668713 14 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type