ID: 1142668717

View in Genome Browser
Species Human (GRCh38)
Location 17:1477546-1477568
Sequence CTCCAGGAAGGTCAGGTCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 332}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668710_1142668717 26 Left 1142668710 17:1477497-1477519 CCACTCACGTCAGGAAGTGTGGA 0: 1
1: 0
2: 0
3: 1
4: 69
Right 1142668717 17:1477546-1477568 CTCCAGGAAGGTCAGGTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 332
1142668707_1142668717 28 Left 1142668707 17:1477495-1477517 CCCCACTCACGTCAGGAAGTGTG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1142668717 17:1477546-1477568 CTCCAGGAAGGTCAGGTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 332
1142668708_1142668717 27 Left 1142668708 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 73
Right 1142668717 17:1477546-1477568 CTCCAGGAAGGTCAGGTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668717 Original CRISPR CTCCAGGAAGGTCAGGTCTG TGG Exonic