ID: 1142669098

View in Genome Browser
Species Human (GRCh38)
Location 17:1479331-1479353
Sequence CCAGCATTGCTGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142669090_1142669098 -7 Left 1142669090 17:1479315-1479337 CCTTCCTTCCATCCCTCCAGCAT 0: 1
1: 1
2: 46
3: 660
4: 6016
Right 1142669098 17:1479331-1479353 CCAGCATTGCTGAGGGAACCAGG 0: 1
1: 0
2: 0
3: 32
4: 213
1142669089_1142669098 30 Left 1142669089 17:1479278-1479300 CCACGGCGCTCGGCTCTCACTCT 0: 1
1: 0
2: 0
3: 23
4: 246
Right 1142669098 17:1479331-1479353 CCAGCATTGCTGAGGGAACCAGG 0: 1
1: 0
2: 0
3: 32
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142669098 Original CRISPR CCAGCATTGCTGAGGGAACC AGG Intronic
900526083 1:3129522-3129544 CCAGGGCTGCTGAGGGCACCTGG + Intronic
901054656 1:6443575-6443597 CCTGCTTGGGTGAGGGAACCAGG - Intronic
903261965 1:22136379-22136401 CCTGCTGGGCTGAGGGAACCTGG + Intronic
903265580 1:22156112-22156134 CCAACAATGCTGTGGGAATCCGG + Intergenic
903276254 1:22223760-22223782 CCAGCATTTCTAGGGGAACCAGG + Intergenic
904118286 1:28178102-28178124 CCTGCCTTGCTGTGGGACCCTGG - Intronic
904407914 1:30305702-30305724 CCACCCAAGCTGAGGGAACCTGG + Intergenic
905169073 1:36099109-36099131 CCAGGATTCCAGGGGGAACCAGG - Exonic
906033875 1:42739114-42739136 CTAGCCTCGCTGAGGGACCCAGG - Intronic
906142454 1:43541943-43541965 CCAGCATGGCTGGGTGAGCCTGG - Intronic
908589238 1:65611700-65611722 GCAGCATTGCTGAGGAAATGTGG - Intronic
912379624 1:109240382-109240404 CCAGGGTTGGTGAGGGACCCAGG - Intergenic
912778206 1:112520276-112520298 CCTGCAGTGCCTAGGGAACCTGG - Exonic
912794773 1:112686115-112686137 CCAGCATTGATCTGGGAGCCTGG + Intronic
913130431 1:115834017-115834039 ACAGCATTCCTGTGGGAAGCGGG + Intergenic
913189845 1:116404341-116404363 CCAGCATTACAGAGGGAAACAGG - Intronic
915903281 1:159861469-159861491 CCAGCTGTGCTGTGGGGACCCGG - Intronic
916811877 1:168312896-168312918 CCAGCATTGCTGTGTCCACCTGG + Exonic
920878451 1:209858847-209858869 CCGGCACTGCTGGGGGACCCAGG + Intergenic
920911380 1:210220629-210220651 CCAAGATTACTGAGAGAACCAGG - Intergenic
922166136 1:223117153-223117175 CCGGCAGTGCTGGGGGACCCGGG + Intronic
1063601033 10:7481777-7481799 CCAGCATTGCCGAGAGAAACAGG - Intergenic
1064113104 10:12555278-12555300 CCAGCACTGCTGAGAGGGCCAGG + Intronic
1065268931 10:24006748-24006770 TTGGCATGGCTGAGGGAACCAGG + Intronic
1065925821 10:30433572-30433594 CCAGCAGTGCTGCGGGAAGCCGG - Intergenic
1067101236 10:43336215-43336237 CCAACATTGCTGTGGCAGCCAGG - Intergenic
1067153145 10:43752985-43753007 CCAGCCTTGCAAAGGGAACATGG + Intergenic
1067842633 10:49693597-49693619 CCAGCAAAGGTGAGGGCACCTGG + Intronic
1068161675 10:53272456-53272478 CCAGCCTTGATGAGGGTAGCTGG - Intergenic
1068532829 10:58208885-58208907 CCAGCCTTGATGAGGGTAGCTGG + Intronic
1071289635 10:84179514-84179536 CCAGGATTGCTGAGTGTGCCAGG + Intronic
1074049400 10:109868374-109868396 CCAGAATGGCTGCGGGAAACAGG + Intronic
1074271329 10:111956822-111956844 ACAGCAATGCTCAGGGAACAAGG + Intergenic
1074671655 10:115798402-115798424 CCAGCAGTGCTGAGGGCAACAGG - Intronic
1076635682 10:131880579-131880601 CCAGGATTTCTGACGGGACCTGG - Intergenic
1077139797 11:1019229-1019251 CCAGCACTGCCGAAGGCACCCGG - Intronic
1079994048 11:27276511-27276533 CCTGCAGTGATGAGGGAATCTGG - Intergenic
1080845620 11:36024390-36024412 GCAGCATTGCTGAGGGATAGAGG - Intronic
1081620264 11:44615166-44615188 CCAGGGTTGCTGAGGGGAACGGG + Intronic
1082940905 11:58704047-58704069 CCAGCACTGCTGAGGGTAGCAGG - Intronic
1083724298 11:64620245-64620267 GCAGCATCGCAGAGGGACCCGGG + Intronic
1084150863 11:67287336-67287358 CCAGCATTGGTGTGGGAAGGAGG + Intergenic
1084219694 11:67670448-67670470 CCCGCATTGCTGAGGGCAGTGGG + Intronic
1085272432 11:75278267-75278289 CCAGCATTGCAGAGGGGGCACGG - Intronic
1086337413 11:85812801-85812823 CCTGCCTTGCTGAGGGAAGCAGG + Intergenic
1087977262 11:104565143-104565165 CCAGCAGTGCTGGGGTAGCCTGG + Intergenic
1088527075 11:110768349-110768371 CCAGCATTACTTAGGGGACAGGG + Intergenic
1089667407 11:120029282-120029304 CAAGCTTGTCTGAGGGAACCAGG + Intergenic
1090223767 11:125055739-125055761 CCAGCATCACTGTGTGAACCAGG + Intergenic
1090540496 11:127698115-127698137 CAAGCAATGCTGATGGAAGCAGG - Intergenic
1090586183 11:128215467-128215489 CCAGCAGTGCTGGGGGGACTCGG + Intergenic
1091554787 12:1564524-1564546 CCAGCACTGCTGGGGGACCAAGG + Intronic
1092583796 12:9876228-9876250 CCGGCACTGCTGGGGGACCCAGG + Intergenic
1093797557 12:23331161-23331183 CAAGCATTGCTGAGGAGAGCAGG + Intergenic
1094313815 12:29115465-29115487 CCATCATGACTGAAGGAACCCGG + Intergenic
1094470488 12:30797044-30797066 CCAGCCTTCCTGCGCGAACCTGG + Intergenic
1096392523 12:51240055-51240077 CCTGCATTCCGGAGGGAACTTGG + Intronic
1100617459 12:96242066-96242088 CCAGCATCGCTCAGGTTACCAGG + Intronic
1101309674 12:103564726-103564748 CCAGTATTGGAGATGGAACCTGG + Intergenic
1101625523 12:106436923-106436945 CCTGGATTGCTGAGGACACCAGG - Intronic
1101840764 12:108325960-108325982 CCAGCATTTCTGACAGAGCCTGG - Intronic
1103743810 12:123108817-123108839 CCAGCAAGGATGAGGGCACCCGG + Intronic
1106341169 13:28828269-28828291 ACAGCAATGTTGAGGGAACAAGG - Intronic
1106465802 13:30013604-30013626 CCAGCCATCCTGATGGAACCCGG - Intergenic
1107036955 13:35911938-35911960 CCATCATAGCTGTGGGACCCTGG + Intronic
1109065871 13:57689353-57689375 CCAGCATGGCTGAGGGAGAAGGG + Intronic
1113885860 13:113658072-113658094 CCAGCGTTACTGCTGGAACCCGG - Exonic
1115252624 14:31365306-31365328 CCAGAATTTCTTAGAGAACCAGG - Intronic
1116216586 14:42024816-42024838 CCAGCAAAGCTGAGGGAGCAGGG - Intergenic
1118730336 14:68661498-68661520 CCAGCATCACAGAAGGAACCAGG - Intronic
1121521111 14:94586853-94586875 CCAGCAGTGCTGATGGTCCCAGG + Intronic
1122796942 14:104210746-104210768 CCGGCATTGCTGCTGGCACCAGG + Intergenic
1123063016 14:105602704-105602726 CCAGCTTTGCTGAGCTAAACTGG - Intergenic
1123984172 15:25630328-25630350 GCAGCATGGCTGAGGGCACATGG + Intergenic
1123989690 15:25674185-25674207 CCAGCAAGCCTGAGGGGACCTGG - Intergenic
1127373317 15:58360005-58360027 CCAGGACAGCAGAGGGAACCAGG - Intronic
1127674609 15:61228141-61228163 CAAGCATTTCTGCAGGAACCTGG - Intronic
1128680335 15:69646955-69646977 CCAGCAGTGCTCTGGGACCCAGG + Intergenic
1128775855 15:70319807-70319829 CCAGCATGGCAGAGGGAAGGAGG - Intergenic
1129170941 15:73807464-73807486 CCAGCAGGGCAGAGGGAACATGG - Intergenic
1129393926 15:75234196-75234218 CCACCAGAGCTGAGGGAAGCAGG + Intergenic
1130514026 15:84612107-84612129 CCAGCCTTTCTCAGGGAGCCTGG + Intronic
1130868981 15:87955439-87955461 ACGGCATGGCTCAGGGAACCTGG + Intronic
1131556029 15:93399850-93399872 CCAGCAGTGCTGAGAGTTCCAGG + Intergenic
1132605035 16:790091-790113 CCATCAGTGCTCAGGGACCCGGG - Intronic
1133933445 16:10250569-10250591 CCAGCATGGCTGATGGAGCCAGG + Intergenic
1135201406 16:20440563-20440585 CCAGCATTGCCCAGTGATCCTGG - Exonic
1136290612 16:29269191-29269213 GCATCCTTGCTGTGGGAACCAGG - Intergenic
1137245130 16:46696683-46696705 CTAGCATGGGTGAGAGAACCAGG - Intronic
1141219978 16:82060337-82060359 GCTGCATTACTGAGGGAAGCTGG + Intronic
1141631625 16:85291178-85291200 CCAGCTCTGCTGAGAGACCCTGG - Intergenic
1142669098 17:1479331-1479353 CCAGCATTGCTGAGGGAACCAGG + Intronic
1143950032 17:10625049-10625071 TCAGCATTGCTGAGGGTAACCGG + Intergenic
1144559605 17:16311121-16311143 CCTGCATGGATGAAGGAACCTGG - Intronic
1144685879 17:17226080-17226102 CCAGCATTGCACAGGGAGGCAGG - Intronic
1145050304 17:19654511-19654533 CTGGCATTGCTGGGGGACCCGGG + Intronic
1145919281 17:28598568-28598590 CCAGAGTTGGTGAGGGCACCGGG + Exonic
1146669142 17:34724863-34724885 GCAGCATTGCTGTGGGAAACGGG - Intergenic
1146838574 17:36133249-36133271 CCAGCAGTGCTGATGCAGCCAGG - Intergenic
1147038423 17:37699129-37699151 CCACCATTGCAGATGGAAACCGG + Exonic
1147844697 17:43396802-43396824 CCTGCATTGCTGGGGAAACCAGG + Intergenic
1150279263 17:63919424-63919446 CCAGCAATGCTCAGGGAAAGGGG - Intergenic
1150998233 17:70343736-70343758 CAAGCATTGCTTTGGGATCCTGG + Intergenic
1152467978 17:80476440-80476462 CCGGCATGGCTGCGGGCACCGGG + Exonic
1152528237 17:80901946-80901968 CAGGCACTGCTGGGGGAACCTGG - Intronic
1153952683 18:10070372-10070394 CTGGCCTTGCTGAGGGAGCCTGG + Intergenic
1154045345 18:10898948-10898970 CCTTCATTGCTTAGGGACCCAGG - Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159656200 18:71031901-71031923 TCAGCATAGCTGGGGGGACCCGG + Intergenic
1160754477 19:750544-750566 CCAGCAGCCCTGAGGGAGCCCGG + Intergenic
1161320681 19:3639459-3639481 CCAGCCTGGCTGATGGAGCCAGG - Intronic
1161992760 19:7694333-7694355 CCAGCCTTGGTGACAGAACCAGG + Intronic
1162791265 19:13064231-13064253 CCAGCATTTCTGAGAGGGCCTGG - Intronic
1163644545 19:18481149-18481171 CCAGGATTGCTGAGGGTGCGGGG - Intronic
1163698755 19:18776831-18776853 CCCTCATGGCTGAGGGAGCCGGG + Intronic
1164538876 19:29107434-29107456 CCAGCATTGCTGAGGGCAGATGG - Intergenic
1164581977 19:29440184-29440206 CCAACAGTGCTGGGGGATCCGGG - Intergenic
1164925301 19:32125364-32125386 GCATCAGTGCTTAGGGAACCTGG - Intergenic
1165969100 19:39610451-39610473 ATAGCAATGCTGAGGGAACTGGG - Intergenic
1166340990 19:42136763-42136785 CCAGCATTGCTGACTGGACAAGG - Intronic
1166369005 19:42291205-42291227 CCAGCCTTGCCCAGGGCACCTGG - Exonic
1166385483 19:42378297-42378319 CCAGCTTTGCTGTGTGACCCTGG - Intronic
926151648 2:10428914-10428936 CAAGCCTTGATGGGGGAACCAGG + Intergenic
926756489 2:16240525-16240547 GCAGCACTGCAGAGGGACCCTGG + Intergenic
927362250 2:22249569-22249591 CCAGCATTTCTGAAGCTACCTGG + Intergenic
929138013 2:38643256-38643278 CCAGCACTGCTGGGGGACCCAGG + Intergenic
929231671 2:39566625-39566647 CCATCATGGCTCAGGGAGCCAGG + Intergenic
936158817 2:110068998-110069020 CCAGCTCAGCTGAGGGAACACGG - Intergenic
936185843 2:110302334-110302356 CCAGCTCAGCTGAGGGAACACGG + Intergenic
937835986 2:126470557-126470579 CCAGCAAGGGTGAGGGATCCTGG + Intergenic
938314953 2:130318884-130318906 CCAGCACTGGTGAGGGAGCAGGG - Intergenic
939458700 2:142470492-142470514 CCAGCATGGGAGAGGGAACTCGG + Intergenic
941429349 2:165393606-165393628 CCAGCAATGGTGAGGGAAGGAGG + Intergenic
942664756 2:178305538-178305560 CCAGCATTTGTGAAGGATCCAGG - Intronic
943015409 2:182503858-182503880 CCAGCATTACTCTAGGAACCAGG - Intronic
943678603 2:190743233-190743255 GCAGCATTGCTCTGGGAACTGGG + Intergenic
944513309 2:200485488-200485510 CCAGCATAGCTGGAGGAATCAGG - Intergenic
946408861 2:219506673-219506695 GCAGCATGGATGAGGGCACCAGG - Intronic
947022186 2:225691771-225691793 ATAGCATTGGTGAGGGAACAAGG - Intergenic
948027542 2:234790085-234790107 CCAGCATTGCTCAGGTGCCCAGG + Intergenic
1169171051 20:3465694-3465716 CCAACACTGCTGAAGGAAGCTGG + Intergenic
1169440700 20:5631623-5631645 CAAGCATTGCTGGGAGCACCAGG - Intergenic
1171182470 20:23100880-23100902 CCAGGAGTGTTGGGGGAACCAGG + Intergenic
1175055666 20:56195355-56195377 CCAGCAGTGCCGAGGGCAGCAGG + Intergenic
1175534231 20:59696613-59696635 CCAGCATTGCTGAGAAGGCCGGG + Intronic
1175681974 20:60995620-60995642 CCAGCCTTCCTGAGGGTGCCAGG - Intergenic
1176254434 20:64143601-64143623 CCAGCTCTGCAGAGGGAACATGG - Intergenic
1179576713 21:42312673-42312695 CCATCATTGATCAGGGAGCCGGG + Intronic
1179803752 21:43824494-43824516 CCAGCCTCGCTGATGGGACCTGG - Intergenic
1179879279 21:44286738-44286760 CCAGCATGGCTGAGTCCACCAGG - Intronic
1181345798 22:22219806-22219828 CCAGCCTGGAAGAGGGAACCTGG - Intergenic
1181572351 22:23774427-23774449 CCAGCCTTGCTGAAGGCAGCCGG - Intronic
1182097520 22:27636107-27636129 CCAGCATGGCTGGGGGACCCAGG - Intergenic
1182301324 22:29338868-29338890 CCAGCAGTGATGAGGGAAGCTGG - Intronic
1183469784 22:37999147-37999169 CCATCTTTGCTGAGAGATCCAGG + Intronic
1183544564 22:38448702-38448724 CCACCATTGCTGAGTGACCCTGG + Intronic
1183662892 22:39231809-39231831 TCAGCAATGGTCAGGGAACCTGG + Exonic
1184653928 22:45931848-45931870 CATGCATGGCTGATGGAACCTGG + Intronic
1184944980 22:47796443-47796465 CCAGCACTGCTGAGGCCACCCGG + Intergenic
1185131738 22:49043316-49043338 CCAGCGTGGCTGAGGCAACAGGG + Intergenic
1185332684 22:50258739-50258761 CCAGGGGTGCTGAGGGGACCAGG - Intronic
950334312 3:12181506-12181528 CCAGCCATGCTGAAGCAACCAGG + Intronic
950667424 3:14505856-14505878 CCAGCTGTGCTGAGTGACCCTGG + Intronic
952495027 3:33908304-33908326 TCAGCATTCCTCAGGGAACTGGG + Intergenic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
958549640 3:95595676-95595698 CCAGCTGTGCTGGGGGACCCGGG + Intergenic
960479549 3:118171560-118171582 CCAGCAGTGCTGGGGGACCCGGG - Intergenic
963461348 3:145617812-145617834 TCAGCTTTGATGAGAGAACCTGG + Intergenic
966638797 3:182165559-182165581 CCAGAACTGCAGAGAGAACCTGG + Intergenic
967121055 3:186383310-186383332 CCAGCCTTGCTGAGGCCACCGGG + Intergenic
967603089 3:191412897-191412919 GCAGCACAGCTGAGGGAACCTGG + Intergenic
968293824 3:197558161-197558183 CCAGCTTTGCTGTGACAACCAGG + Intronic
968552698 4:1231848-1231870 CCAGCCGTGCTGAGGGAGCCTGG - Intronic
969315497 4:6379189-6379211 CAAGCACTGCTGAGGAAAGCCGG - Intronic
970483469 4:16501189-16501211 GCACCACAGCTGAGGGAACCTGG - Intergenic
971840720 4:31848515-31848537 CCAGCATGGGTGATGGAACAAGG + Intergenic
977686562 4:99853285-99853307 TCTGCATTGCTGTGTGAACCCGG - Exonic
978140624 4:105313567-105313589 CCAGGATTAATGAGGGAACAAGG + Intergenic
978809094 4:112830972-112830994 CCAGCAGTGCTGGGGGACCCGGG - Intronic
983155109 4:164337441-164337463 TCTGCATAGCTGAGGGAACCAGG - Intronic
984183003 4:176508259-176508281 CAAGCATTGATGAGGCAAGCAGG + Intergenic
985802754 5:2016182-2016204 CCAGCCTTGCTGTGGGTCCCAGG + Intergenic
986200053 5:5571627-5571649 CCAGGAGTGCTGAGGGACACAGG - Intergenic
996567219 5:124892609-124892631 CCTGCAGTGCTGGGGGACCCGGG - Intergenic
998804363 5:145904274-145904296 CCAGCATCGCTGAGGAAACATGG + Intergenic
999294358 5:150449391-150449413 ACAGCGTAGTTGAGGGAACCCGG - Intronic
999656427 5:153815200-153815222 CAACCATTGCTAATGGAACCTGG - Intergenic
1000085872 5:157887014-157887036 CCGGCAGTGCTGGGGGAACCCGG - Intergenic
1000262357 5:159600155-159600177 CCAGCAGAGCTGTGGGAACAGGG - Intergenic
1001522072 5:172401976-172401998 ACAGCAATGTTGAGGGAACAAGG + Intronic
1002078922 5:176726419-176726441 CCAGCACTGCCGAGGACACCAGG + Intergenic
1003032163 6:2611264-2611286 CCAGCATTGCTGCTGCAGCCTGG + Intergenic
1003111276 6:3253737-3253759 CCGGCAGTGCTGGGGGACCCGGG - Intronic
1003759174 6:9155879-9155901 GCAGCAATGCAGAGGGAACCTGG + Intergenic
1004027878 6:11836873-11836895 CCTGCACAGCTGAGGGGACCTGG + Intergenic
1008156675 6:48023888-48023910 CCATCATTGCTATGGTAACCAGG - Intronic
1009055212 6:58326877-58326899 CCAGAAAGGCTGAGGGATCCTGG - Intergenic
1011130996 6:84051756-84051778 CCAGGAGTGGTGTGGGAACCTGG + Intronic
1014494742 6:122107343-122107365 CAAGCATGGCTGAGTGAAGCAGG + Intergenic
1016391630 6:143580844-143580866 CCCAGAATGCTGAGGGAACCAGG + Intronic
1017042185 6:150316457-150316479 CCAGCAAGGCTGAGGGGTCCTGG + Intergenic
1018029597 6:159831546-159831568 CCAGGATGGCTGAGAGAACTTGG + Intergenic
1018109400 6:160520460-160520482 CCGGCAGTGCTGGGGGGACCCGG + Intergenic
1018679997 6:166256575-166256597 CCAGGATTGCTCAGGGAATAAGG + Intergenic
1019311657 7:364838-364860 CCAGCAGTCCTTAGAGAACCAGG + Intergenic
1021754786 7:23841782-23841804 CCAGCCTTGATGAGGGTAGCTGG + Intergenic
1023023289 7:36029757-36029779 CCAGCAATGCTGAGGGACTGTGG + Intergenic
1024095159 7:45977036-45977058 CCAGCCTTGCTGAGTGCACCTGG - Intergenic
1028732436 7:94166869-94166891 CCAGCATTGTTGAAGGAATTAGG - Intergenic
1030594011 7:111514565-111514587 CCAGCTTTACTGAGGTAAACTGG - Intronic
1032434436 7:131888538-131888560 CCATGATTGCTGAGGGAGCCAGG - Intergenic
1034257183 7:149731114-149731136 CCAGCACTCCTGAGGGGGCCAGG - Intronic
1034940620 7:155228099-155228121 CCAGCCTTGCAGAGGCAACGCGG - Intergenic
1035372708 7:158389667-158389689 CCAGCCTGGCTGCTGGAACCAGG + Intronic
1035463894 7:159063333-159063355 CCGGCACTGCTGGGGGAACCCGG + Intronic
1036753950 8:11460251-11460273 CCAGCATTGCCGATGGGAGCGGG + Intronic
1040776213 8:51045940-51045962 AAAGCACTCCTGAGGGAACCTGG - Intergenic
1041670845 8:60490292-60490314 CCAGTGTTGGGGAGGGAACCTGG - Intergenic
1042028561 8:64449407-64449429 AGAGTATTGCTGAGGGAGCCAGG + Intergenic
1042443987 8:68862241-68862263 CCAACATTGATGTGGGAACCAGG + Intergenic
1044793561 8:95872688-95872710 GCAGCATGGCTCAGGGAAGCAGG - Intergenic
1045813946 8:106257881-106257903 ACAGCAATGTTGAGGGAACAAGG + Intergenic
1046251884 8:111642992-111643014 CCGGCACTGCTGGGGGGACCTGG - Intergenic
1047495685 8:125407065-125407087 CCAGCAGGGCTGAGGCAGCCAGG - Intergenic
1048154009 8:131924608-131924630 CCAGAAAGGCTGAGGGAAACAGG - Intronic
1048736932 8:137512652-137512674 ACTGCATTGCTGAGGGAAGCAGG + Intergenic
1048857635 8:138697949-138697971 TCTGCATTGCTGCGGGAGCCTGG - Intronic
1051569376 9:18538305-18538327 CCAGCATTGTTGTGTGAAACAGG + Intronic
1052339906 9:27354702-27354724 CCTGCATTGCTTAGGGTTCCTGG - Intronic
1052991883 9:34523279-34523301 CCACCAATGGTGCGGGAACCGGG - Intergenic
1053536898 9:38935406-38935428 CCAGCAAGCCTGTGGGAACCTGG - Intergenic
1054629238 9:67428524-67428546 CCAGCAAGCCTGTGGGAACCTGG + Intergenic
1056799443 9:89681256-89681278 CCAGCACTGCTGGGGGACCCGGG - Intergenic
1058636556 9:107043960-107043982 CCAGCATTCCAGAAGGAACAGGG - Intergenic
1059481331 9:114592723-114592745 CCAGCATAGCTCAGAGATCCTGG + Intronic
1061261978 9:129485443-129485465 CCACCAGAGCTGAGGGCACCGGG + Intergenic
1061375595 9:130222617-130222639 GCAGCACTGCTGAGTGATCCTGG - Intronic
1061736705 9:132665883-132665905 CCAGAATCACTGAAGGAACCAGG + Intronic
1062060394 9:134492385-134492407 CCAGCAGTGCTCAGGGCCCCCGG - Intergenic
1062121841 9:134838110-134838132 TCAGCCATGCAGAGGGAACCGGG + Intronic
1062123266 9:134845734-134845756 GCAGCATTGCCCAGGGAAGCTGG + Intergenic
1185609456 X:1385915-1385937 CCAGCATTTATCAGGGAGCCCGG + Intergenic
1187261140 X:17686383-17686405 TCAGCAGTGCTGAGGGAATGAGG + Intronic
1198250717 X:134877012-134877034 TCAGCATTACTGAGGCAGCCAGG + Intergenic
1198498099 X:137214155-137214177 CCAGGAGTGCTGAGTGAACATGG + Intergenic
1198834374 X:140786033-140786055 GCAACATTGCTGAAGGCACCTGG - Intergenic