ID: 1142670255

View in Genome Browser
Species Human (GRCh38)
Location 17:1484812-1484834
Sequence CAGGTGCTTTGGAGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142670247_1142670255 17 Left 1142670247 17:1484772-1484794 CCAGGTGACCTCAGGTCCCTCAG 0: 1
1: 0
2: 5
3: 21
4: 259
Right 1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG 0: 1
1: 0
2: 1
3: 30
4: 285
1142670249_1142670255 1 Left 1142670249 17:1484788-1484810 CCCTCAGCTCTGAGCCACGTGTG 0: 1
1: 0
2: 1
3: 17
4: 177
Right 1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG 0: 1
1: 0
2: 1
3: 30
4: 285
1142670248_1142670255 9 Left 1142670248 17:1484780-1484802 CCTCAGGTCCCTCAGCTCTGAGC 0: 1
1: 0
2: 3
3: 49
4: 494
Right 1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG 0: 1
1: 0
2: 1
3: 30
4: 285
1142670250_1142670255 0 Left 1142670250 17:1484789-1484811 CCTCAGCTCTGAGCCACGTGTGA 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG 0: 1
1: 0
2: 1
3: 30
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142670255 Original CRISPR CAGGTGCTTTGGAGGACAAA TGG Intronic
902136348 1:14309483-14309505 CAGGGGCCTTGGAGGCCACAGGG + Intergenic
902972646 1:20065425-20065447 CAGGGGTTTGGGAGGACAGAGGG - Intronic
904237846 1:29125485-29125507 CCCGTGCTTGGGTGGACAAAGGG - Intergenic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906420823 1:45665339-45665361 CATGTGCTCTGGAGCTCAAAGGG + Intronic
908825788 1:68131562-68131584 GAGGTGCTTTGGAGGTCCATGGG - Intronic
912883656 1:113445708-113445730 CAGAAACTTTGGAGGCCAAAAGG + Intronic
915112177 1:153571019-153571041 CAGGTGCTTGGAAGCACAGAAGG - Intergenic
916040579 1:160957848-160957870 CCAATGCTTTGGAGGAAAAAAGG + Intergenic
916775515 1:167959475-167959497 CAGTCACTTTGAAGGACAAATGG - Intronic
917019255 1:170568787-170568809 CATGGGATTTGGTGGACAAAAGG - Intergenic
918165884 1:181947497-181947519 CAGGTCCTTCCCAGGACAAATGG - Intergenic
918699876 1:187595318-187595340 CAGAAGCTATGGAGGACAATAGG - Intergenic
923212016 1:231812035-231812057 CAGGTGCTATGAAGTACAGAGGG + Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
1067315283 10:45155675-45155697 CAAGTGCATTGGAGGAAAATGGG - Intergenic
1069571153 10:69495161-69495183 GAGGGGCTCTGGAGGGCAAAGGG + Intronic
1069642990 10:69968313-69968335 CTGGAGCTTTGGAGGCCATATGG - Intergenic
1069656966 10:70097152-70097174 CAGGGTCTTGGGAGGAGAAATGG + Intronic
1071752575 10:88497151-88497173 AAGTTGTTTTGGAAGACAAACGG + Intronic
1073159387 10:101376751-101376773 AAGGTGCTTTGTAGGTCATAGGG + Intronic
1074156522 10:110804924-110804946 CAGGTGCTTTTGAGGGCAGAGGG + Intronic
1075192127 10:120319274-120319296 CAGGTGCTGAGGAGGACAGGAGG + Intergenic
1075702362 10:124477867-124477889 CAGGTGCTCAGGAGGACATAGGG - Intronic
1077117485 11:891713-891735 CAGGTGGTTGGGAGGACTACAGG - Intronic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1078114368 11:8430740-8430762 TATGTGCTTTGGAGGACACAAGG - Intronic
1079224146 11:18590332-18590354 CAGGTGTTGTGGAGGACCATTGG + Intergenic
1079502331 11:21115478-21115500 TGGGTGCTGTGGAGGACAGAGGG + Intronic
1079625392 11:22611106-22611128 CAGATGCCTAGGAGGAAAAATGG - Intergenic
1081596256 11:44461617-44461639 AAGGTGCTTGGGAGGACACAGGG + Intergenic
1082003012 11:47404101-47404123 CAGTTGGTTTGGAGGCCATAGGG - Intergenic
1083791732 11:64990098-64990120 TAGGTGGTTTGGGGGACACACGG - Intronic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1087200543 11:95340510-95340532 CAGGTACTTTGATGGACACAGGG - Intergenic
1088069887 11:105769382-105769404 CAGATGATGTGGAGGAAAAAGGG + Intronic
1088684612 11:112274371-112274393 AATGTTCTGTGGAGGACAAATGG + Intergenic
1090740718 11:129657857-129657879 CAGGAGCTGTGCAGGGCAAAGGG + Intergenic
1090921179 11:131207148-131207170 GGGGTGCTGTGGAGGGCAAATGG - Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1091662713 12:2396554-2396576 CTGGTGTTTTGGAGGACCACAGG - Intronic
1091846808 12:3662555-3662577 CATGGACTGTGGAGGACAAAGGG + Intronic
1092620261 12:10257031-10257053 CAGAAGCTTTGGAGGCCACAAGG - Intergenic
1092804977 12:12213024-12213046 CAGCTTCTTTAGAGGACTAATGG + Intronic
1092994875 12:13940409-13940431 GAGATGAGTTGGAGGACAAACGG - Intronic
1093099666 12:15012650-15012672 GAAGTGGTTGGGAGGACAAAGGG + Intergenic
1093692620 12:22125181-22125203 CAGAGGCTTAGGAGGAAAAATGG + Intronic
1094351474 12:29530655-29530677 CAGGTGCTTTGAAGGAGGAAGGG - Intronic
1095867062 12:46983684-46983706 CAGGTGCTTTGGATGCCTGAAGG - Intergenic
1096333665 12:50736541-50736563 CAGCAGCTTTGCAGGACAGAAGG - Intronic
1097095763 12:56546866-56546888 CAGCTGCTTTGGAGGATAGTTGG - Intronic
1097680972 12:62648458-62648480 CAGGGGATTGGGAGGACAGAGGG - Exonic
1098428570 12:70393827-70393849 AATGTGCCTTGGAGGACAAGGGG - Intronic
1100757651 12:97769665-97769687 CAGGGGCTATGGAGACCAAACGG - Intergenic
1101377719 12:104185114-104185136 CATGTGCTTTGTAGGATAAATGG - Intergenic
1103064277 12:117884048-117884070 AGGTTGCTTTGCAGGACAAACGG - Intronic
1103104193 12:118208618-118208640 CAACTGCTTTGAAGGACAAATGG + Intronic
1108438870 13:50428257-50428279 AAGTTACTTTGGAAGACAAAAGG - Intronic
1110796540 13:79645137-79645159 CAGGTGCTTTGGAGAATAGAGGG - Intergenic
1111694216 13:91603200-91603222 CAGGTGGTCTGGATGAGAAACGG - Intronic
1113412222 13:110100485-110100507 CCGGTGCTTTGGTGAGCAAAGGG - Intergenic
1114038417 14:18652271-18652293 CAGGAGTTATGGGGGACAAAGGG + Intergenic
1114876723 14:26729618-26729640 CAGGTGGTTTCAAGGATAAAAGG + Intergenic
1115051893 14:29072815-29072837 CAGAGGCTTAGGAGGAAAAATGG - Intergenic
1116226498 14:42160416-42160438 CAGGTGCTTGTGAGGGTAAAGGG - Intergenic
1117312660 14:54543575-54543597 CAGCTGCTTTGGAAAACAATTGG - Intergenic
1118316851 14:64730955-64730977 TAGGTGCTTGGGAGGACCGAGGG - Intronic
1119056492 14:71427362-71427384 CAGAAACTTTGGAGGCCAAAAGG - Intronic
1119115855 14:72020873-72020895 CATGTGCTCTGAAGGAGAAATGG + Intronic
1121329537 14:93041257-93041279 AAGGTACTTTGTAGGACAGAGGG - Intronic
1121696246 14:95914606-95914628 AAGGTGCTTAGCTGGACAAAAGG + Intergenic
1122583339 14:102785859-102785881 CAGGTCCTTGGGATGACAGAGGG + Intronic
1124859140 15:33421137-33421159 CTGGTGAATTGGAGGAGAAACGG + Intronic
1125119244 15:36133547-36133569 CAAGTGCAGTGGAGGACATAAGG - Intergenic
1127833609 15:62772203-62772225 CAGGTACTTGGGAGGCTAAATGG - Intronic
1128172427 15:65524599-65524621 CAGGTACTTTGAAGGATGAAGGG + Intergenic
1128347457 15:66863538-66863560 AAGGTGCTATGGGGGACTAAAGG - Intergenic
1128565860 15:68700092-68700114 CAGGTGCTTTGAAGGAGGCAGGG - Intronic
1129625708 15:77196586-77196608 CATGGGCTTTGGAGAAAAAAGGG + Intronic
1131592311 15:93762722-93762744 CACGTGCTTTGGAAGAAAAAGGG + Intergenic
1131597545 15:93813457-93813479 CAGGTGCTTCCCAGGACAAAAGG - Intergenic
1131948128 15:97650782-97650804 CGTGTGCTTTGTTGGACAAAGGG + Intergenic
1135882330 16:26270008-26270030 CTGGTGTTTTGGGGGGCAAAAGG + Intergenic
1136059833 16:27718889-27718911 CAGCTGCGGTGGAGGACAAAGGG - Intronic
1137764244 16:50965542-50965564 AAAGTGCTTTGTGGGACAAAGGG + Intergenic
1137837430 16:51606282-51606304 CAGGAGCTCTGGAGTGCAAATGG - Intergenic
1142670255 17:1484812-1484834 CAGGTGCTTTGGAGGACAAATGG + Intronic
1143450304 17:7032337-7032359 CAGAGGCCTTGGAGGACAGAGGG - Intergenic
1145741003 17:27274607-27274629 CCTGGGCTTGGGAGGACAAAGGG - Intergenic
1145790740 17:27625105-27625127 CAGGTGTGTGGGAGGCCAAAGGG - Exonic
1146090461 17:29872646-29872668 AAGGTGCTATGGAGTACAAGAGG + Intronic
1147477738 17:40729429-40729451 CAGCTACTAGGGAGGACAAAGGG - Intergenic
1147626812 17:41905716-41905738 CTGGTGCCTGGGAGGACACACGG + Intronic
1149191834 17:54072454-54072476 GAGTTCCTTTGGAGGAGAAAAGG + Intergenic
1149578806 17:57733076-57733098 CAGGTGCTGGAGAGGACAGAGGG - Intergenic
1156264340 18:35472669-35472691 CTGCTTCTTTGGAGGACAATTGG - Intronic
1157052764 18:44187457-44187479 CAAGTGCTTTACAGGAGAAAGGG - Intergenic
1157571909 18:48718170-48718192 CAGATGGTTTGGAAGAAAAAAGG - Intronic
1157651513 18:49337334-49337356 GAGGTTCTCAGGAGGACAAAAGG - Intronic
1157956209 18:52100300-52100322 CAGGCCCTGTGGAGGAGAAAGGG + Intergenic
1157964530 18:52192770-52192792 CATTGGCTTTGGGGGACAAAAGG + Intergenic
1158406732 18:57166386-57166408 CAGGTGCTTCAGAGGAAAAATGG + Intergenic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1159955120 18:74513556-74513578 CAGGCTCTTTGGTGGACAAGAGG + Exonic
1161061473 19:2217278-2217300 CAGGTGCCATGGAGGACATGGGG + Intronic
1161616390 19:5273176-5273198 CATGTGCTTCTGATGACAAAAGG - Intronic
1163203940 19:15788609-15788631 CAGCTGCTTAGGAGGCCAAGTGG - Intergenic
1165498564 19:36169300-36169322 AAGGTGCTGGGGAGGAGAAATGG - Intergenic
1166061462 19:40328304-40328326 AAGGTGCTTTGAAGGCCACAAGG - Intronic
1166160827 19:40951567-40951589 CAGGTGCTGCAGAGGCCAAAAGG - Intergenic
1166496597 19:43307287-43307309 CAGGTGATTTGATGGAGAAATGG + Intergenic
1167238395 19:48328591-48328613 CAGGTGCATTGGAGTTCTAAAGG + Intronic
1167823356 19:51949744-51949766 CTGGAGCTTTGGAGGCCCAAGGG + Intergenic
1168283756 19:55320453-55320475 CAGATGCTGGGGAAGACAAAGGG + Exonic
1168322481 19:55518368-55518390 CAGGTGCTGTGAAGGTCAACTGG - Exonic
926926447 2:17993093-17993115 CAGGGGCCTAGGAGGAAAAATGG + Intronic
927585505 2:24300152-24300174 CAGTTACTTTTGAGGACAAACGG - Exonic
927893579 2:26767411-26767433 CAGGTTCTTGGGAGGATGAAAGG + Intronic
928484807 2:31718809-31718831 CAGGTTATTTGGAGGAAAGAGGG - Intergenic
928698985 2:33879870-33879892 AAGCTGATTTGGAGAACAAAGGG + Intergenic
930864987 2:56113670-56113692 CATGTGCTTTAGCTGACAAAGGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
931533725 2:63248280-63248302 CAGAAGCTTTGGAGGCCAGAAGG - Intronic
932091280 2:68808435-68808457 GAGAAGCTTTGGAGGAAAAATGG - Intronic
933625123 2:84589596-84589618 CAGGTACTTGGGAGGCTAAACGG + Intronic
934138691 2:89023040-89023062 TGGGTGCTGTGGAGGACAAGGGG + Intergenic
935499702 2:103823492-103823514 TAGCTGCTTTGGAGGATAAGAGG + Intergenic
937630842 2:124099443-124099465 CAGGTGCTGTGCTGGACAATAGG - Intronic
938029929 2:127983408-127983430 CAAGTGCTTTTGAGGAGAAATGG + Intronic
938335420 2:130491306-130491328 CAGCTGCATTGAAGGACAACAGG - Intronic
938354404 2:130629361-130629383 CAGCTGCATTGAAGGACAACAGG + Intronic
938415447 2:131100259-131100281 CAGGTGGGCTGGAGGAGAAAGGG + Intergenic
938430825 2:131236144-131236166 CAGCTGCATTGAAGGACAACAGG + Intronic
938917894 2:135962300-135962322 GATCTGCTTTGGAGGAAAAAGGG - Intronic
938923253 2:136014779-136014801 CACGAGGTTTGGAGGACAAAGGG + Intergenic
939093804 2:137809401-137809423 CAGTTGCTTTTGAGGACTGATGG + Intergenic
939513401 2:143135728-143135750 CAGGTAGTTTGGAGGAAAACTGG - Intronic
940996804 2:160158619-160158641 TATGTGCTTTGCAGGCCAAACGG + Intronic
943252081 2:185537558-185537580 AATGTCCTTTGGAGGTCAAATGG - Intergenic
944205037 2:197149614-197149636 CTGCTGCTTTGGAGAACTAAAGG - Intronic
945016187 2:205519626-205519648 GAGGTTGTTTGGAGGACATATGG + Intronic
945846237 2:214948479-214948501 CAGGTGGTTTTGAGGGGAAATGG + Intronic
947855830 2:233323896-233323918 CAGATGCTGTGGAGAACAAGAGG + Intronic
948097830 2:235350448-235350470 CAGGTGCTATGGAAGGCACACGG + Intergenic
1168911011 20:1446719-1446741 CAGGTGGTTTGGAGGAGAGAAGG - Intronic
1169103454 20:2973183-2973205 CAAGTTCTTTGGAAGAAAAAAGG - Intronic
1169407835 20:5338392-5338414 CAGAAACTTTGGAGGCCAAAAGG + Intergenic
1169695649 20:8384578-8384600 GAGGTCCTTTGGAGGAGAAGAGG + Intronic
1169787124 20:9370957-9370979 CTGGTGCTTGGGAGAACAAGGGG - Intronic
1170391457 20:15879467-15879489 TAGGTGCTTTGTAGAGCAAAAGG + Intronic
1170444248 20:16408836-16408858 CAGGTGCTTAGAAGAAGAAAGGG - Intronic
1170531003 20:17291614-17291636 CAATTGCTGTGGAGGACAATTGG - Intronic
1170718488 20:18853124-18853146 CAGAAACTTTGGAGGACAGAAGG - Intergenic
1172003530 20:31800776-31800798 TATGTGCTTTGGAGCCCAAAAGG - Intronic
1172814244 20:37673692-37673714 CAGGTGCTTTGGAGGCAGGAAGG - Intergenic
1174139655 20:48404041-48404063 GAGGTGATTTGGAAGACAAGGGG + Intergenic
1174515744 20:51091163-51091185 CAGGTGCTTAGGTGGAAAAATGG - Intergenic
1174546997 20:51333102-51333124 CAGGTGATTTAGAGGATTAAAGG + Intergenic
1178264689 21:31132171-31132193 CAGGCCCTTTGGAGGCCAACTGG + Intronic
1179566551 21:42252667-42252689 AAGGTGCTTGGAAGGACAAGGGG + Intronic
1180998562 22:19977421-19977443 CAGCTGCTTTGGAGGCAAGAAGG - Exonic
1181918786 22:26302865-26302887 CAGCAGCTTGGGAGGACAGATGG + Intronic
1182376577 22:29852982-29853004 CCTGTGCTTTGGAGGACCTAGGG - Intergenic
1182624797 22:31638047-31638069 CCAGTGGTTTGGAGGACAGAGGG - Intronic
1182736395 22:32534391-32534413 AAGAGGCTGTGGAGGACAAAGGG + Intronic
1184501038 22:44872157-44872179 CAGGTGCTTGGGAGCACACAGGG - Intergenic
950534782 3:13572493-13572515 CAGGTGGCTTGGAGGATATAGGG - Intronic
950545433 3:13635347-13635369 CAGGCACCCTGGAGGACAAAAGG - Intronic
950635122 3:14308716-14308738 CAGGGGGTGGGGAGGACAAAGGG + Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951499003 3:23362724-23362746 CAGGTGTTTCCCAGGACAAAGGG - Intronic
953190679 3:40684406-40684428 CAGGAGGTTTGGAGGGCAAAGGG - Intergenic
954201269 3:49024745-49024767 CTGGTGCTGTGCAGGACAAAGGG - Exonic
954464391 3:50646063-50646085 CAGGGGCTTTTGAGGGGAAATGG + Intronic
955472016 3:59295785-59295807 CAGGTGTTTTTCAGGACAACAGG - Intergenic
955507357 3:59645581-59645603 CAGGTGGTTGGAAGGACTAATGG - Intergenic
955800582 3:62681924-62681946 GAGGTCCTCTGGAGAACAAAAGG - Intronic
956209485 3:66788442-66788464 CAGATTCTTTGGATGAGAAAAGG - Intergenic
956261936 3:67353227-67353249 CAGGTGCTTTGCATCACAATTGG - Intergenic
957702704 3:83738307-83738329 AATTTGGTTTGGAGGACAAATGG - Intergenic
958955195 3:100459025-100459047 CAGGGGCCTAGGAGGAAAAATGG - Intergenic
960736279 3:120784621-120784643 CAGGTGGTGTAGAGGACAGATGG - Intergenic
960787243 3:121387374-121387396 CAGTTGCTTTGCCGGACAGAAGG + Intronic
960850719 3:122050965-122050987 CAGAAACTTTGAAGGACAAAAGG - Intergenic
961486491 3:127220979-127221001 CAAGGGCTGGGGAGGACAAAAGG + Intergenic
962314355 3:134349940-134349962 CAAGAGCTTTGGGGGAAAAAAGG - Intergenic
962473070 3:135731117-135731139 CAGGTGCTTCCCAGGACAACAGG + Intergenic
963348004 3:144119024-144119046 CAAATGCTGTGGAGCACAAAAGG + Intergenic
963929426 3:150987938-150987960 CAGAAGCTTTGGAGGCTAAAAGG - Intergenic
964964251 3:162471216-162471238 CAGGTGTTTTGAAAGACAAATGG - Intergenic
965499476 3:169440705-169440727 CAGAAGCTTTGGAGGGCATATGG - Intronic
965682602 3:171266845-171266867 CATCTGCTTTGGAGAACAGAAGG - Intronic
967148484 3:186626762-186626784 CATGTGGTCTGGAGGACAGAAGG - Intergenic
967471582 3:189868354-189868376 GAGGTTCTTTGGAGAACAAATGG + Intronic
967532453 3:190564650-190564672 CAGGTCCTATGGGGGAAAAATGG + Intronic
968578570 4:1379213-1379235 CAGGAGCTGGGGAGGACAGATGG - Intronic
969511207 4:7618957-7618979 CAGGTGCTTCCGAGGACCTATGG - Intronic
969609269 4:8217974-8217996 CAGGTGCTTTGGAGGTCTGCAGG + Intronic
969937476 4:10696557-10696579 GAGTTTCTCTGGAGGACAAAAGG - Intergenic
971983493 4:33787998-33788020 CAGCTGCATGGGAGGACCAAAGG + Intergenic
973788388 4:54356450-54356472 CAGCTGCCTTGGATGTCAAATGG - Intergenic
975245993 4:72120834-72120856 GTGGTCCTTTGGAGGAGAAAAGG - Intronic
976112950 4:81696363-81696385 CAGGTGCTGTGCTGGATAAAAGG + Intronic
976285890 4:83370759-83370781 AAGGTGCTCTGGAGCACAAATGG - Intergenic
977320048 4:95502380-95502402 CAGCTGCTTGGGAGGCCGAAAGG - Intronic
979166560 4:117539850-117539872 CAGCTGCTGTGCAGGAGAAAAGG + Intergenic
979538150 4:121848376-121848398 CAGGTGATATGTTGGACAAAGGG - Intronic
980756375 4:137169562-137169584 ATGGAGCTTTTGAGGACAAACGG + Intergenic
984954433 4:185031513-185031535 CAGCTGCTTGGGAGAACAAGGGG + Intergenic
985471287 5:48474-48496 CAGGTGCTAGGGAGAACACAGGG + Intergenic
985573864 5:664794-664816 CACGTGGTTTGCAGGTCAAAGGG - Exonic
986201366 5:5581947-5581969 AAGGTCCTTTTGAGGACAAGCGG + Intergenic
989187410 5:38638538-38638560 TGGGTGCTGTGGAGGTCAAATGG + Intergenic
990632209 5:57682718-57682740 GAGGTGCTTGGGAGGAAGAAAGG + Intergenic
991071715 5:62490395-62490417 CAGGTAGTTTGCAGGAGAAAAGG + Intronic
991245176 5:64502899-64502921 GTGGTGCTTTGGAGAACTAAGGG - Intergenic
992809947 5:80376649-80376671 CAGGAGCTTTGGAAAACAGATGG + Intergenic
993048170 5:82892755-82892777 CTGGTGCTGTGCAGGACCAATGG + Intergenic
995011432 5:107260470-107260492 CAGAGGCCTTGGAGGAAAAATGG - Intergenic
995105989 5:108379353-108379375 GAGGTGCATTTTAGGACAAAGGG - Intronic
995470761 5:112499709-112499731 CAGGTAGTTTGGAGGCCACAGGG - Intergenic
996494184 5:124134227-124134249 AAGGTGTTATGGAAGACAAAAGG + Intergenic
996764678 5:127023918-127023940 CACCTGCATTGGATGACAAAAGG + Intronic
998776539 5:145609823-145609845 CAGGTGCTTCCCAGGACAACAGG + Intronic
1000429605 5:161135655-161135677 CCGGCGCTTTGGGGGACAGAGGG - Intergenic
1001711305 5:173780566-173780588 GGTGTGCTTTGGAGAACAAAAGG - Intergenic
1001820191 5:174704286-174704308 CAGGTTCTTCCAAGGACAAAAGG + Intergenic
1002380577 5:178825323-178825345 CAGGATCTTTGTAGGACACAAGG + Intergenic
1002549861 5:179979671-179979693 CTGGTGGCTTGGAGGACCAAGGG - Intronic
1002756226 6:162881-162903 CAGAAGCTGTGGAGGAGAAATGG + Intergenic
1003000661 6:2329373-2329395 CAGGTGCTTTCTATGACAATGGG - Intergenic
1003027487 6:2568775-2568797 CAGTTACTTTGGAGGACAGTTGG - Intergenic
1003165775 6:3677227-3677249 CAGATCCTTTGGAGGAGAAGAGG + Intergenic
1003337162 6:5185057-5185079 CAGGGGCTGGGGAAGACAAAGGG - Intronic
1006277855 6:33020518-33020540 CAACTGCTTTGGAGAACAACAGG + Intergenic
1006500169 6:34453319-34453341 CCAGTGCTTTGGGGGACCAATGG + Intergenic
1007505651 6:42333414-42333436 CGGGTCCTTTGGATAACAAAGGG - Intronic
1008596149 6:53043935-53043957 TAGGTGTTTTGTAGGGCAAATGG + Intronic
1008964449 6:57300254-57300276 CAGGTGCTTGTGAGGACAGAGGG - Intergenic
1009960538 6:70515590-70515612 CAGGGGCTCTGGGGGACAGAGGG + Intronic
1010712666 6:79193272-79193294 GAGGTGCTTTGAAGAACATAAGG + Intergenic
1011760817 6:90563165-90563187 AAGGAGCTTTGGAGGAGAAGAGG - Intronic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1015330190 6:131968837-131968859 CATGTGCTCTGGAGGAAGAAGGG + Intergenic
1017130805 6:151106901-151106923 CAGTTGGTTTCTAGGACAAAAGG + Intergenic
1017290787 6:152733509-152733531 CAAGTGCCTTGGAGGAAAAAGGG + Intergenic
1017733573 6:157339713-157339735 CAGGTGGTTTGGGGGACAGGCGG + Intergenic
1018301260 6:162405098-162405120 CAGGAGCTCTGCAGGACACATGG - Intronic
1019584194 7:1787876-1787898 CAGGTGCTGTAGAGGAAAAAGGG - Intergenic
1020349796 7:7206797-7206819 CAGACACTTTGGAGGACAGAAGG - Intronic
1020806311 7:12794585-12794607 CAGGTCCCTTGCAGGACACATGG + Intergenic
1023337009 7:39180845-39180867 AAGGTGCTCTGGAAGGCAAAGGG - Intronic
1023978046 7:45047314-45047336 CATGTCCTTTGGTGGATAAATGG + Intronic
1026506987 7:70993334-70993356 CAGAGGCTTTGGAGGAAGAATGG - Intergenic
1027351198 7:77313295-77313317 CAAGTGCTTTGTAGGCCAAGTGG + Intronic
1028628668 7:92907692-92907714 CAGCCACTTTGGAAGACAAATGG - Intergenic
1029401792 7:100351727-100351749 CTGGTGCATTGGAGGTGAAAGGG + Intronic
1034440816 7:151085306-151085328 CAGGTGCTTTGGAAGGTACAAGG + Intergenic
1035113712 7:156505702-156505724 GAGGTGGTTTGGGGGATAAAAGG - Intergenic
1035893439 8:3371189-3371211 CATGTGTTTGGGAGGCCAAAAGG - Intronic
1036074737 8:5483529-5483551 CAGGTTCTTTGCTGGACAGAAGG + Intergenic
1036218918 8:6904074-6904096 CTGTTGCTGTGGAGGTCAAATGG + Intergenic
1037058631 8:14478518-14478540 CAGGTGTTATGGGGGACAGAGGG + Intronic
1037896178 8:22657843-22657865 CAGCTGCTTTGGAGGGCATGGGG + Intronic
1038262519 8:26009039-26009061 CAGGAGCTTTTGTGGACACATGG + Intronic
1039916202 8:41862114-41862136 CAGGTCCTTGGGAGGCCAGAGGG - Intronic
1040410997 8:47153840-47153862 CTGATCCTTTGGAGGAGAAAAGG - Intergenic
1040581575 8:48703008-48703030 CAAGACCTTTGGAGAACAAAAGG - Intergenic
1040698112 8:50027157-50027179 CGGGTGCTTTGATGGTCAAAGGG + Intronic
1040706635 8:50136565-50136587 CAGGTGTTTCTCAGGACAAAAGG - Intronic
1042137153 8:65643597-65643619 CAGGAGCTTTGGAGCCGAAAGGG - Intergenic
1043357529 8:79430751-79430773 CAAGTTCCTTGGAGGAAAAAGGG - Intergenic
1043863406 8:85348921-85348943 CAGGTGTTAAGGAGGACACAAGG + Intronic
1044076342 8:87826218-87826240 TAGGTTTTTTGGAGAACAAATGG + Intergenic
1044221968 8:89679447-89679469 GTGGTGATTTGGAGGAGAAAAGG - Intergenic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1044520150 8:93189621-93189643 CTGGAGCTTTGGAGGAAAAGAGG + Intergenic
1047356805 8:124129701-124129723 CAGGTGCTTCCCAGGACAACAGG - Intergenic
1047683894 8:127283898-127283920 CAGGTGCTGTGGGGACCAAATGG - Intergenic
1047775927 8:128070471-128070493 CAGGTGCTGGCGAGGACAGAGGG - Intergenic
1048070029 8:131011702-131011724 CAGGTGTTGTGTCGGACAAAGGG + Intronic
1049265638 8:141666566-141666588 AAGGGGATTTGGAGGACAAAGGG - Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049671929 8:143873752-143873774 CAGAGCCTTTGGAGAACAAAAGG - Intronic
1049674169 8:143882509-143882531 CAGGTGCCTTGGAGGATTGAGGG - Intergenic
1049845151 8:144797149-144797171 CAGATTCTTTGGGGGACCAAGGG - Intergenic
1052769055 9:32670790-32670812 CAGATGCCTTGGTGGACCAAAGG + Intergenic
1053360732 9:37485186-37485208 AAGGTGATTTGGAAGACAGAGGG + Intergenic
1056053847 9:82799989-82800011 CAGGAGCTTTGGAGGAAGCAGGG + Intergenic
1056278679 9:85018525-85018547 CAGATGCTTTGGAGGACTTGCGG - Intronic
1056808571 9:89746724-89746746 CTGGTGTTTTGGTGGAGAAACGG - Intergenic
1056972051 9:91213382-91213404 CAGGTGTTTGTTAGGACAAAGGG + Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1057157624 9:92857566-92857588 GAGGGTCTTTAGAGGACAAAAGG + Intronic
1057723933 9:97555006-97555028 CAGGGAATTTGAAGGACAAAGGG + Intronic
1057845312 9:98518153-98518175 CAACTGCTCTGGAGGACAAGGGG - Intronic
1058453078 9:105114915-105114937 CAAGTGCTGTGGAGCACAGAGGG + Intergenic
1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG + Intronic
1059815787 9:117911990-117912012 CAGAAACTTTGGAGGCCAAAAGG + Intergenic
1061644397 9:131988724-131988746 CAGTTCCTTGGGAGGCCAAAGGG - Intronic
1061825886 9:133257872-133257894 CAGGGGCTTTGGAGAACAAAGGG + Intronic
1185473243 X:397696-397718 GGGTTCCTTTGGAGGACAAAGGG - Intergenic
1185854471 X:3521250-3521272 CAGGTCCTTGGGAGGTCAGAAGG + Intergenic
1187643120 X:21316497-21316519 CAGTTGCTTTGGAGGCTATATGG + Intergenic
1187988438 X:24841523-24841545 CATGTGCTTTTGAGTTCAAATGG + Intronic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1192679455 X:73236686-73236708 CAGGCACTTTGAAGGAGAAACGG - Intergenic
1193620393 X:83746438-83746460 CAGGTCCTTTGATGGACACATGG - Intergenic
1195469687 X:105218644-105218666 CAAGTGCTCTGGAATACAAAGGG + Intronic
1197999801 X:132421139-132421161 TAGGTGCTTTGAAAGAAAAAAGG + Intronic
1198226078 X:134647159-134647181 CAGGAGCTGTGGGGGACAAGAGG - Intronic
1198466330 X:136907894-136907916 CAAGAGCTTTGGAGAACAAGAGG - Intergenic
1199450758 X:147976697-147976719 CAGGTGATCTGTAGGACAACGGG + Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic
1200362111 X:155618181-155618203 CAGGTGTTGAGGAGGAGAAAGGG - Intronic
1201545055 Y:15152805-15152827 CAGTTGCTTTTAAGGACTAAAGG + Intergenic