ID: 1142672635

View in Genome Browser
Species Human (GRCh38)
Location 17:1494159-1494181
Sequence GCCCCCAACACATATACCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142672635_1142672646 16 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672646 17:1494198-1494220 GGGGGAAAACTCAGCAAGAAGGG No data
1142672635_1142672642 -3 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672642 17:1494179-1494201 GGCAGGGATAGGTTACCATGGGG No data
1142672635_1142672647 17 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672647 17:1494199-1494221 GGGGAAAACTCAGCAAGAAGGGG No data
1142672635_1142672643 -2 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672643 17:1494180-1494202 GCAGGGATAGGTTACCATGGGGG No data
1142672635_1142672641 -4 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672641 17:1494178-1494200 GGGCAGGGATAGGTTACCATGGG No data
1142672635_1142672645 15 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672645 17:1494197-1494219 TGGGGGAAAACTCAGCAAGAAGG No data
1142672635_1142672640 -5 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672640 17:1494177-1494199 GGGGCAGGGATAGGTTACCATGG No data
1142672635_1142672648 23 Left 1142672635 17:1494159-1494181 CCCTAGGTATATGTGTTGGGGGC No data
Right 1142672648 17:1494205-1494227 AACTCAGCAAGAAGGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142672635 Original CRISPR GCCCCCAACACATATACCTA GGG (reversed) Intergenic
No off target data available for this crispr