ID: 1142672745

View in Genome Browser
Species Human (GRCh38)
Location 17:1494767-1494789
Sequence AGGTGTCTTCTCCTGGGAAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142672734_1142672745 28 Left 1142672734 17:1494716-1494738 CCTCAGTCCCAGGACACAGGATG 0: 1
1: 0
2: 1
3: 40
4: 318
Right 1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG 0: 1
1: 0
2: 4
3: 32
4: 289
1142672738_1142672745 20 Left 1142672738 17:1494724-1494746 CCAGGACACAGGATGGCAGGACA 0: 1
1: 0
2: 1
3: 40
4: 307
Right 1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG 0: 1
1: 0
2: 4
3: 32
4: 289
1142672733_1142672745 29 Left 1142672733 17:1494715-1494737 CCCTCAGTCCCAGGACACAGGAT 0: 1
1: 0
2: 1
3: 19
4: 280
Right 1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG 0: 1
1: 0
2: 4
3: 32
4: 289
1142672737_1142672745 21 Left 1142672737 17:1494723-1494745 CCCAGGACACAGGATGGCAGGAC 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG 0: 1
1: 0
2: 4
3: 32
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142672745 Original CRISPR AGGTGTCTTCTCCTGGGAAA AGG Exonic
900152255 1:1183784-1183806 AGGTGTGACCTCCAGGGAAAGGG - Intronic
900641222 1:3688972-3688994 CGGTGTCCTCTCCTGCCAAAGGG - Intronic
901066187 1:6495796-6495818 TGGTGTCTTCATCTGGAAAACGG + Intronic
902220781 1:14963336-14963358 AGGTGTCTCCACCTGAGAAATGG - Intronic
903061464 1:20671690-20671712 CGGTGTCTTCATCTGTGAAATGG - Intronic
903616219 1:24659699-24659721 AGGTTTCCTCTCTTGTGAAATGG + Intronic
904428643 1:30447696-30447718 AGGTGCCTTCCACTGGGAGAGGG + Intergenic
905390466 1:37633151-37633173 AGGTCTCTTCCCCTGTAAAATGG - Intronic
910761922 1:90741429-90741451 ATGTGCCTCCTGCTGGGAAAGGG + Intergenic
912638491 1:111320997-111321019 AGGTGTCATCTCCTGAGAAAGGG - Intergenic
914938480 1:152001365-152001387 AGTTGTCTTCTCCTTGGAAAAGG - Intergenic
914981643 1:152419844-152419866 AGCTGTGCTCTCCTGAGAAATGG - Intergenic
915027777 1:152848793-152848815 AGGTGTCTTGCCCTTGGAATGGG - Intergenic
915263931 1:154701212-154701234 ACAAGTTTTCTCCTGGGAAAAGG - Exonic
915299296 1:154942811-154942833 AGGTGGCTGGGCCTGGGAAAGGG - Intergenic
915408946 1:155685927-155685949 AGCTGTATTCTTCTGGAAAATGG - Intronic
915822742 1:159042755-159042777 TGTTGTCTTCCCCTAGGAAAGGG - Intronic
915823109 1:159046915-159046937 TGTTATCTTCTCCTAGGAAAGGG - Intronic
919348748 1:196420664-196420686 AGGAGTTTCCTCATGGGAAATGG - Intronic
920066237 1:203272023-203272045 AAGTCTCCTCACCTGGGAAAAGG - Intronic
920965034 1:210694389-210694411 AGGTATCTTATCCTGGGTAGAGG + Intronic
921160179 1:212466907-212466929 AGGTGTCTTCCCAGGGGAAGTGG + Intergenic
922219699 1:223549087-223549109 CGGTTTCTTCACCTGTGAAACGG + Intronic
923155418 1:231274153-231274175 AGGTATCTTCCCCAGGCAAATGG + Intronic
923257684 1:232235211-232235233 AGGTGTAATCTCCTGGGCTAGGG - Intergenic
924378419 1:243437947-243437969 AGCTGTCTTCCTCTGGGAAATGG - Intronic
1067041268 10:42954440-42954462 AGGTGCCCTCTCCTGGGAGGTGG - Intergenic
1067433067 10:46256612-46256634 TGGTGGCAGCTCCTGGGAAAGGG - Intergenic
1067440198 10:46304812-46304834 TGGTGGCAGCTCCTGGGAAAGGG + Intronic
1067455203 10:46414261-46414283 AGGTGTGTCCTCCTTGGAAGGGG - Intergenic
1067468706 10:46520900-46520922 ATGTGTGTTTTTCTGGGAAAAGG + Intergenic
1067631997 10:47970373-47970395 AGGTGTGTCCTCCTTGGAAGGGG + Intergenic
1067829431 10:49601787-49601809 AGGTGTCCTCCCTTGGGTAAGGG - Intergenic
1068323027 10:55444748-55444770 AGGTGGCTTCAAATGGGAAATGG - Intronic
1069326622 10:67238624-67238646 AGGTCTGTTCACCTTGGAAAGGG + Intronic
1070374452 10:75815894-75815916 ATGTGACTTCTCCTGCAAAATGG - Intronic
1071864613 10:89713563-89713585 AGGTGTATACTCCAAGGAAATGG + Intronic
1072609946 10:97011322-97011344 AGCTCTCTTCTACTAGGAAAGGG - Intronic
1073844499 10:107538446-107538468 ACATGTCCTCTTCTGGGAAATGG - Intergenic
1074314330 10:112347826-112347848 CGGTCTCTTCTTCTGTGAAATGG - Intergenic
1075304190 10:121353310-121353332 AGTTTTCTTCTCATTGGAAATGG + Intergenic
1076806493 10:132861725-132861747 AGGTGTCTTCTGCAGTGGAAAGG + Intronic
1077222263 11:1422976-1422998 CTGTGTCCCCTCCTGGGAAAGGG + Intronic
1077800162 11:5529031-5529053 ACGTATCTTCTCATGGAAAAAGG - Intronic
1078797010 11:14602230-14602252 AGGTGTCTAGTTCTGGGAAACGG - Intronic
1079656943 11:22996374-22996396 AGGTGTCTTCTGGTTTGAAAGGG + Intergenic
1080925676 11:36753636-36753658 AGGTGTCTGGGACTGGGAAAAGG + Intergenic
1081621235 11:44620183-44620205 GGATGGCTTCTCCTGGGAGAAGG + Exonic
1081866998 11:46365715-46365737 AGGTGTCCCCTCATGGGACATGG - Intronic
1083093505 11:60224195-60224217 TTGTGTTTTCTCTTGGGAAAAGG + Intronic
1083269325 11:61563493-61563515 TAGTTTCTTCTCCTGTGAAATGG - Intronic
1084588033 11:70074560-70074582 AGGTGTGTGCACCTGTGAAATGG + Intergenic
1085382506 11:76133250-76133272 AGGTGTCCTCTTCTGTGAAATGG - Intronic
1087689122 11:101298667-101298689 AGGTGTCTTCTCTTAGGTAAGGG - Intergenic
1088190732 11:107225775-107225797 AGCTCTCTTCCCCTGTGAAATGG + Intergenic
1088262083 11:107953836-107953858 AGGTGTCATCTCCTGGAAATGGG + Intronic
1090490523 11:127156626-127156648 TGGTTTCCTCTCCTGTGAAATGG + Intergenic
1090716069 11:129432525-129432547 GTGGGTGTTCTCCTGGGAAAGGG - Intronic
1091611215 12:2011341-2011363 AGGAGCCTTGTCCTGGGACATGG + Intronic
1092318198 12:7441389-7441411 CTGTGGCTTTTCCTGGGAAAAGG - Intronic
1092399498 12:8162161-8162183 AGGTGTCTTCTGGTTTGAAAGGG - Intronic
1093702315 12:22235834-22235856 TGGTTTGTTCTCCTGGGTAATGG - Intronic
1094643545 12:32299476-32299498 ATGTTTCTCCGCCTGGGAAAAGG - Intronic
1096741835 12:53699168-53699190 TGGTTTCTTCTTCTGTGAAATGG - Intergenic
1096908936 12:54962799-54962821 ATGTGTCTTCTGCTGTGAAGAGG - Exonic
1098374268 12:69796873-69796895 AAGTGTCTTCTCATGGAACATGG + Intronic
1098392110 12:69980572-69980594 ATGTGTTTTCTCTTGGGAGAGGG + Intergenic
1101979578 12:109393892-109393914 AGATGTCTTCTCCGGGAAGAGGG + Intronic
1102858562 12:116315900-116315922 AGGTGACTTCTCCTGGCATCTGG - Intergenic
1103444304 12:120984057-120984079 AGGTGGCTTCTCCCAGAAAAGGG + Intronic
1103673652 12:122638971-122638993 AGGGGTCATCTCCAGGAAAATGG + Intergenic
1106329458 13:28726073-28726095 TGGTGTCTTATCCTGGGGGAGGG + Intergenic
1107945328 13:45413005-45413027 GGTAGTCCTCTCCTGGGAAAAGG - Intronic
1109730876 13:66412050-66412072 ATGTGTCTTCTCCCATGAAAAGG - Intronic
1109795575 13:67308666-67308688 AGGTTTCATCTCCTAGGAGATGG - Intergenic
1110039727 13:70737913-70737935 AGGTATCCTCTTCTGGGAAATGG - Intergenic
1111461343 13:88546351-88546373 ATGTGTCTTCTTATGGCAAAAGG + Intergenic
1112669784 13:101621736-101621758 AAAAGTCTTCTCTTGGGAAAAGG + Intronic
1113336515 13:109382171-109382193 GGGTGCCTTTTCCTGGGACAGGG - Intergenic
1113377435 13:109778445-109778467 AGTTGTCTGCTCCTGCGAATAGG + Intronic
1115478525 14:33839437-33839459 CAGTTTCTTCCCCTGGGAAAGGG - Intergenic
1117249183 14:53918375-53918397 AGGTGTCTTCACATGGTAAAAGG + Intergenic
1117830576 14:59745820-59745842 AGGGGTCTTCTCTTGGGTAGTGG + Exonic
1119690106 14:76664957-76664979 AGGTGTCTTCCCAAGGGAAAAGG + Intergenic
1121324124 14:93009960-93009982 AGTTGTCTCCTCCTGAAAAATGG + Intronic
1122436380 14:101703799-101703821 AAGCGACTTCTCCTGGGAATTGG - Intergenic
1123000785 14:105293039-105293061 AGGTGCCTGCTCTTAGGAAACGG - Intronic
1123697816 15:22891701-22891723 AAGTGTTTGCACCTGGGAAACGG - Intronic
1124955170 15:34355666-34355688 AGGTTTCTTCTTCAGGAAAACGG + Exonic
1127519221 15:59726846-59726868 AAGTTTCTTCTCCTGGGCACTGG - Intergenic
1127562416 15:60152409-60152431 AGGTGACTTCTCCTAAGAGAAGG + Intergenic
1127670095 15:61186922-61186944 TGCTGGCTTCTCTTGGGAAATGG + Intronic
1127872165 15:63082829-63082851 AGGTCCCTTCTCTAGGGAAAAGG + Intergenic
1129003859 15:72355943-72355965 AGAAGTCTTCTCCTGGCAAAGGG + Intronic
1129774974 15:78230478-78230500 TGGTGGCTGCTCCTGGGGAAAGG - Intronic
1132306284 15:100815908-100815930 AGGTTTATTTTGCTGGGAAAAGG + Intergenic
1133048430 16:3102321-3102343 AGCTGTGTTCTCCAGGGGAAAGG - Intergenic
1134060924 16:11199045-11199067 ACGTGTCTGCTTCTGGGGAAGGG + Intergenic
1136165861 16:28452578-28452600 AGGTTTCTTCATCTGTGAAATGG - Intergenic
1136197111 16:28662443-28662465 AGGTTTCTTCATCTGTGAAATGG + Intergenic
1136213450 16:28776568-28776590 AGGTTTCTTCATCTGTGAAATGG + Intergenic
1136258183 16:29056498-29056520 AGGTTTCTTCATCTGTGAAATGG + Intergenic
1136320312 16:29479822-29479844 AGGTTTCTTCATCTGTGAAATGG - Intergenic
1136434885 16:30219163-30219185 AGGTTTCTTCATCTGTGAAATGG - Intergenic
1136535907 16:30899401-30899423 GGGGGTCTTCTGGTGGGAAAGGG - Exonic
1137386599 16:48048079-48048101 TGGTGCCTTCTTCTGTGAAATGG - Intergenic
1137863852 16:51873449-51873471 AGGTGTCTTCACATGGCACAAGG - Intergenic
1138832282 16:60389436-60389458 AGTTGTCTTCTCTTGGGTAAAGG + Intergenic
1139315065 16:66060862-66060884 AGGACTATGCTCCTGGGAAAGGG - Intergenic
1139796225 16:69485122-69485144 AGGTGTGTTCACCTGGAAAACGG - Intergenic
1140035624 16:71369275-71369297 CAGTTTCTTCTCCTGTGAAATGG - Intronic
1141473393 16:84254730-84254752 AGATGTGTTCTACTAGGAAAGGG - Intergenic
1141696514 16:85622581-85622603 AGGTGTATTTTCCTGGGGAGAGG + Intronic
1141750214 16:85953407-85953429 CGGTGTCTTCCTCTGTGAAATGG - Intergenic
1141752986 16:85971873-85971895 AGGGGTTTTCTTGTGGGAAAGGG - Intergenic
1141827680 16:86492719-86492741 CTGTTTCTTCTTCTGGGAAATGG - Intergenic
1142032824 16:87846916-87846938 CGGTGTCTTCCCCTGGGAAATGG - Intronic
1142672745 17:1494767-1494789 AGGTGTCTTCTCCTGGGAAAAGG + Exonic
1142814222 17:2412691-2412713 CTGTGTCTCCTGCTGGGAAAAGG - Intronic
1144419534 17:15083623-15083645 CAGTGTCCTCCCCTGGGAAATGG - Intergenic
1144493280 17:15732319-15732341 AGGTGTCTGGTTCTGAGAAAAGG + Exonic
1144906981 17:18644333-18644355 AGGTGTCTGGTTCTGAGAAAAGG - Intronic
1145784664 17:27586173-27586195 AGGTGTCCTCTCCTCCCAAAGGG - Intronic
1145905839 17:28515799-28515821 AGGTGTATACACCTGGGGAATGG - Intronic
1148837040 17:50470735-50470757 AGGTGGCTGCTCCAGGGAAACGG + Intronic
1149078156 17:52621771-52621793 AGGTGTTTTTTCCTAGGAAAAGG - Intergenic
1150524443 17:65907632-65907654 GGGTGTCTTCTCCAGATAAATGG + Intronic
1153572140 18:6483939-6483961 AACTGTCTTCTCCAGGGAATTGG + Intergenic
1155803341 18:30136344-30136366 TGGTGTCTTCACCTGGGAACTGG + Intergenic
1155873824 18:31060399-31060421 AGGAGTGTTCCCCTGGGAACAGG - Exonic
1156048451 18:32903730-32903752 AGGTTTCTGCTCTGGGGAAATGG + Intergenic
1157228333 18:45889025-45889047 ATGTTTCTTTTACTGGGAAAGGG - Intronic
1157395287 18:47336069-47336091 TGGTGTCTACTCCTGAAAAAGGG + Intergenic
1158278061 18:55790396-55790418 AGCTGTCTAGTCCTGGGATAGGG - Intergenic
1159819682 18:73124414-73124436 AGGAGCCTTCTCCTGGTACATGG + Intergenic
1160063206 18:75550708-75550730 AGGGGTCATCTTCTGGGCAAGGG - Intergenic
1160936798 19:1599939-1599961 TGGTGTCCTCGCCTGGGAACAGG - Intronic
1161025685 19:2035688-2035710 AAGGGTCTCCTCCTGGGAGAGGG - Intergenic
1161565113 19:4997583-4997605 CAGTTTCCTCTCCTGGGAAATGG + Intronic
1164551379 19:29215405-29215427 AGCTGTCTTCTCGTGGAAGAAGG + Intergenic
1165053929 19:33161578-33161600 AGCTGTCTTCTCCTAGGACTTGG + Intronic
1165894611 19:39133987-39134009 AGGGGTCTTCACCTGGGGACGGG - Intronic
1166569811 19:43786860-43786882 AGGTGGCTTCTCCCACGAAAAGG + Intergenic
1167505155 19:49867359-49867381 ACGCGTCGTCGCCTGGGAAACGG - Intronic
925063110 2:908724-908746 CTGTGTCTTCACCTGGGGAAAGG - Intergenic
925581855 2:5418571-5418593 TCTTGTCTTCTCTTGGGAAATGG - Intergenic
926188537 2:10709964-10709986 AGGTGTATCCACTTGGGAAATGG - Intergenic
926452726 2:13025093-13025115 AGTTATCTTCTCCTGGCACAGGG + Intergenic
926750103 2:16191997-16192019 AGTTCTCTCCTCCTGTGAAATGG - Intergenic
928791852 2:34966184-34966206 TGTAGGCTTCTCCTGGGAAAAGG - Intergenic
929487430 2:42367428-42367450 TGGGGTCTTCTCCCGAGAAATGG + Intronic
929625650 2:43403908-43403930 AGCTGTCAGCTCCTGGGAAATGG + Intronic
930357008 2:50333742-50333764 AGGTGCCTTCTGCTTGGAATAGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
934707789 2:96496902-96496924 AGATGCCTTTTCCAGGGAAAGGG + Intergenic
935322599 2:101903507-101903529 AGGATTCTTTTCATGGGAAATGG + Intergenic
935813404 2:106823426-106823448 GTGTGTTTTCTGCTGGGAAAAGG - Intronic
936953993 2:118006107-118006129 AAGTGTTTTCTCTTGGGAGAAGG + Intronic
937350413 2:121156777-121156799 AGGTGTCTTCTGCTGGGCTGAGG - Intergenic
937387879 2:121453501-121453523 TGGTGTCTTTTCCTTTGAAAAGG - Intronic
938384628 2:130855476-130855498 AGGTGTCCCCTCCTAGGAAGTGG + Intronic
938628426 2:133137854-133137876 AGGTGTGTTCTCATGGCAACTGG - Intronic
938953940 2:136281734-136281756 AGGTTTCCTCTCCTGTGAACTGG + Intergenic
939749521 2:146025660-146025682 AGTTTTCTTTTCCTGGGAAGTGG - Intergenic
942077096 2:172366024-172366046 ACTTGTTTTCTCCTAGGAAATGG + Intergenic
942158599 2:173158110-173158132 AGGTTTCTTCCCCTGTGAAAGGG + Intronic
942637865 2:178028040-178028062 AGGCATCTTCTACTGGGAAAAGG + Intronic
942700045 2:178696938-178696960 GGGTTTGTTTTCCTGGGAAAGGG + Intronic
943731256 2:191305787-191305809 TGGTGTGGTCCCCTGGGAAATGG + Intronic
945016092 2:205518467-205518489 AGGTGTCATTTCATGTGAAATGG + Intronic
946030308 2:216698402-216698424 AGGAGTGATCTCCGGGGAAACGG - Intergenic
946396590 2:219446448-219446470 AAGTGTCTTCTCTGGGGGAAGGG - Intronic
948268450 2:236656297-236656319 AGGGGTCAGCTCCTGGGAAGAGG - Intergenic
948596454 2:239082537-239082559 AGATGGCTTCGTCTGGGAAATGG - Intronic
948667447 2:239545534-239545556 AGGTGGCTTCTCCTGGGGCTGGG - Intergenic
1168871384 20:1131518-1131540 AGGAGTCATCTCCGTGGAAATGG + Intronic
1169044838 20:2526960-2526982 AGGTGTGTTCTCTGGGAAAATGG + Intergenic
1170655467 20:18283408-18283430 AGGAGTCTGCCCCTGAGAAATGG - Intergenic
1171063288 20:21987471-21987493 AGGTGTCTTCACCTGGAGACAGG - Intergenic
1171458278 20:25283932-25283954 AGGGGTCTTCTCATGGGAAAAGG - Intronic
1173178218 20:40781447-40781469 GGCTGCCTTCTCCTGGGAAAGGG + Intergenic
1173200417 20:40950694-40950716 CAGTTTCTTCTCCTGTGAAATGG + Intergenic
1173722511 20:45271904-45271926 AGTTTTCTTCTGCTGAGAAATGG - Intergenic
1173791137 20:45828497-45828519 AGTTACCTTCTCCAGGGAAAGGG + Intronic
1175678694 20:60968745-60968767 TGGCATCTTCTCCTGGGAGACGG - Intergenic
1175835661 20:61992700-61992722 TGGTTTCTTCTAGTGGGAAATGG - Intronic
1178716628 21:34970420-34970442 ATCTGTCTTCTCCCAGGAAAAGG - Intronic
1178795698 21:35742374-35742396 TAGTGACTTCACCTGGGAAAGGG - Intronic
1181391776 22:22588257-22588279 AGGTGACACCTCCAGGGAAATGG + Intergenic
1181420227 22:22792577-22792599 AGGTGACACCTCCAGGGAAAGGG + Intronic
1182082051 22:27536441-27536463 TGATGTTTTCTGCTGGGAAAGGG + Intergenic
1183129359 22:35818985-35819007 ATGTGTTTTGTTCTGGGAAAGGG - Intronic
1183676507 22:39301768-39301790 CAGTTTCTTCTCCTGTGAAACGG + Intergenic
1184361161 22:44019616-44019638 AGGCTGCTTCTCCTGGCAAAAGG + Intronic
1184846108 22:47088243-47088265 TGGTTTCTTTTCATGGGAAACGG - Intronic
1185095734 22:48805018-48805040 TGGCGTCTTCTCCTGGGCGAAGG + Intronic
1185297061 22:50059628-50059650 CGGGGTCTGCTCCTGGGAATGGG - Exonic
1185368378 22:50447229-50447251 CGTTGTCTTCACCTGGGGAAGGG + Exonic
950115530 3:10448313-10448335 AGTTTTCTTCTCCTGGAAAATGG - Intronic
950400637 3:12767005-12767027 AGATGTCTGCGCCTGGGGAAGGG + Intronic
950446152 3:13039958-13039980 TGGTTTCTTCACCTGGAAAATGG + Intronic
951280393 3:20741938-20741960 AGTTGGCTTCTCTTGGTAAAGGG - Intergenic
952758652 3:36894440-36894462 AGATATTTTCTCCTGGGATAAGG - Intronic
952875874 3:37943847-37943869 AGGAGCGTTCTACTGGGAAAAGG + Intronic
953083688 3:39646018-39646040 TGGTGGCTTCTCTTGGGTAATGG - Intergenic
953207437 3:40843931-40843953 AGGTGTCAGCTCCTGGCTAAGGG + Intergenic
953283172 3:41578696-41578718 AGGAGTCTTGTGGTGGGAAAAGG + Intronic
953405549 3:42658009-42658031 CTGGGTCATCTCCTGGGAAATGG - Intronic
953584390 3:44186657-44186679 AGGTGGTTTTTCCTGGGAAATGG - Intergenic
953889604 3:46742508-46742530 TGGGGTGTTGTCCTGGGAAAAGG - Exonic
954629523 3:52040433-52040455 AGGTGCTTTATCCTGGGACAAGG + Intergenic
961195387 3:124997195-124997217 CGGTTTCCTCTCCTGAGAAATGG - Intronic
961627699 3:128275169-128275191 CGGTTTCCTCTCCTGGGAAATGG + Intronic
961797652 3:129421334-129421356 TGGTGTCTTCATCTGGCAAATGG + Intronic
962016653 3:131447932-131447954 ATGTGTCTTCACATGGAAAAAGG + Intergenic
964548607 3:157861946-157861968 ATGTGTCTTCTCCTGCTGAATGG + Intergenic
965379131 3:167966721-167966743 AGGTGTCTGCTGCTGGAAAATGG - Intergenic
966017666 3:175162248-175162270 ATGTGGGTTCTCATGGGAAAAGG - Intronic
967462661 3:189764406-189764428 AGGTGTCTTCATCAGGTAAAAGG + Intronic
968253850 3:197247519-197247541 ATCTATTTTCTCCTGGGAAACGG + Intronic
973952265 4:56028114-56028136 AGGTGTCTTCAACTGACAAAAGG - Intronic
974115556 4:57575419-57575441 AGGTGGCTGCTTCTGGGGAAGGG - Intergenic
975281882 4:72570031-72570053 AGGTGTCTACGCCTGGGAGGTGG - Intergenic
975718579 4:77228839-77228861 AGGTGCCTTTTCCTAGGAAAGGG - Intronic
976011301 4:80492750-80492772 AAGGGTTTTCTCCTGGGCAAAGG + Intronic
976947104 4:90783647-90783669 AAGTGTTTTCTCCTTGGAAGAGG - Intronic
977414840 4:96720214-96720236 ATGTGTCTTTTCATGTGAAATGG + Intergenic
979749759 4:124264383-124264405 AGATGTCTGCATCTGGGAAAAGG + Intergenic
981621375 4:146703434-146703456 AGGTGTCATCTCATGGCAGAAGG + Intergenic
982020917 4:151203233-151203255 AGCTGACTCTTCCTGGGAAAGGG - Intronic
982437248 4:155393675-155393697 AGGTGTCTGTTCCTGGCAAGTGG - Intergenic
983054289 4:163083624-163083646 AGGAGTCTTCTCCTAGAAACAGG + Intergenic
983265575 4:165504571-165504593 AGGCTTCCTCTCCTGGGCAAAGG + Intergenic
983729900 4:170979693-170979715 AGGTGTCTTCTGTAGGGAATGGG + Intergenic
985420596 4:189781487-189781509 AGCTGTCTTCTTCTAGGAATGGG + Intergenic
986209570 5:5658201-5658223 GGGTGTCTTCTACAGGGAATGGG - Intergenic
986488830 5:8268956-8268978 ATGTGTCTGTTCATGGGAAAAGG + Intergenic
987872573 5:23639924-23639946 AGTTCTCTTCTCCTGGGCATAGG + Intergenic
990422935 5:55654725-55654747 TGGTCTCTTCACCTGGAAAATGG + Intronic
992527516 5:77627761-77627783 AGAAGTCTTCCCGTGGGAAAAGG + Intergenic
993102785 5:83561722-83561744 AAGTGTCTCTTCCTGGGTAAGGG - Intronic
994440378 5:99795857-99795879 AGGTGTCATCTCTAAGGAAACGG - Intergenic
995066652 5:107870251-107870273 AGGTGTCATGTCATGGGAAGTGG - Intronic
996317386 5:122175711-122175733 AGGTGTCAGCTTCTGAGAAAAGG - Intronic
997105393 5:131013090-131013112 ATATGTCTTCTTCTGAGAAATGG - Intergenic
997414057 5:133711504-133711526 AGGTCTCTTCCCATGGGAAAAGG + Intergenic
997723873 5:136104202-136104224 ATGTTTCTTCTCCTGCGAAATGG + Intergenic
999020686 5:148162644-148162666 ATGTGTTTTCTCCTAGGAAGAGG + Intergenic
1000606305 5:163331234-163331256 AGGTGTGTTCTCATGGCAACCGG - Intergenic
1001654009 5:173335639-173335661 AGGTGTTGCATCCTGGGAAACGG + Intergenic
1003715354 6:8640161-8640183 AGGTATCTTCTCGTGATAAAAGG - Intergenic
1004120186 6:12814038-12814060 ATGTGTCTTCACAGGGGAAATGG - Intronic
1004195968 6:13505782-13505804 TGGTGTCCTCTGCTGGGACATGG + Intergenic
1004738092 6:18428434-18428456 AGGTCTCTACTCTTTGGAAATGG - Intronic
1005386369 6:25289125-25289147 AGGAGTGTTCTCCTGAGGAATGG + Intronic
1005501879 6:26435959-26435981 TGGTGTATTGCCCTGGGAAAGGG - Intergenic
1006318446 6:33304741-33304763 AGGTTTCTTCTCCTGAAATAGGG + Intronic
1007221713 6:40284023-40284045 ATGTGTCTTGTCTTGGGAAATGG + Intergenic
1007415956 6:41691330-41691352 CGGTGTCTTCTCCTCTAAAATGG - Intronic
1009502367 6:64431061-64431083 AGGTCTTTGCTCCTGGCAAATGG - Intronic
1009652100 6:66489588-66489610 AGGTGTCTGTCCCAGGGAAATGG - Intergenic
1009741228 6:67748530-67748552 CTGTGTCTTCTTCTGGGGAAAGG + Intergenic
1011045714 6:83080468-83080490 AGGTTTTTTCTCTTGGCAAAGGG - Intronic
1011191124 6:84729434-84729456 AGCTGATTTCTCCTGGGGAAAGG + Intronic
1012383383 6:98647838-98647860 AGATGTCTTCACCTGAAAAAAGG + Intergenic
1012455714 6:99402809-99402831 AAGCGTATTCTTCTGGGAAAAGG - Intronic
1012986600 6:105882828-105882850 AGGAAACTTCTCCTGTGAAAGGG - Intergenic
1014882539 6:126741535-126741557 ACTTGTATTCTCCTTGGAAAGGG - Intergenic
1014893760 6:126874085-126874107 TGGTGTCATCTCATGGCAAAAGG - Intergenic
1016663883 6:146611939-146611961 AGGTGGCATATCCTGGGAAATGG + Intronic
1017543965 6:155431666-155431688 AGGTGTCTTCCTCAGTGAAAGGG + Intronic
1017908537 6:158773254-158773276 ACCTGTCTTCTGCAGGGAAAGGG - Intronic
1018511440 6:164528537-164528559 ATATGTTTTCTCCTGGCAAAAGG - Intergenic
1018664836 6:166126040-166126062 AGGTATTTTCTGCTGGGAGACGG + Intergenic
1018736705 6:166691970-166691992 GGGTGACTGCTCCTGGGACACGG - Intronic
1019835488 7:3378929-3378951 AGGGGTCTGCTCCGGGGAAGGGG - Intronic
1020081592 7:5288942-5288964 CGGTGTCTTCTTCTGGAAAAGGG + Intronic
1020133901 7:5575205-5575227 AGGTGTCTCGGCCTGGGAAAGGG - Intergenic
1021115099 7:16738558-16738580 AGGTGTTCTCTCTTGGAAAAGGG - Intergenic
1024291890 7:47811056-47811078 AGGTCTCTAGTCCTGGGAGATGG - Intronic
1028311999 7:89350341-89350363 ATGTGACCTATCCTGGGAAAAGG + Intergenic
1028584530 7:92439863-92439885 AGGTGTCTTCACATGGTAGAAGG - Intergenic
1031942840 7:127807654-127807676 AAGTGTCATCTGCTGGTAAAGGG - Intronic
1032538576 7:132684922-132684944 GTGTGCCTTCTCCTGGGGAAGGG + Intronic
1033420637 7:141201646-141201668 AAGTGGCTTGTCCTGGGAATGGG + Intronic
1035486461 7:159230240-159230262 AGGTGTCTGACCCTGGGCAAGGG + Intergenic
1035869964 8:3126916-3126938 AGGTGCCTTCACCTAGGAGACGG + Intronic
1036587954 8:10142326-10142348 TGGTTTCCTCTCCTGGAAAATGG - Intronic
1037530870 8:19772121-19772143 AGGTGTCCTCGCATGGGGAAAGG - Intergenic
1037784223 8:21893042-21893064 AAGGGTCTTCTCCAGGGAAGGGG - Intergenic
1038700612 8:29846273-29846295 AGGTACCTTCTACTGGAAAATGG + Intergenic
1041162347 8:55058477-55058499 AGCTGTTTTCTCCTGGAAAGAGG + Intergenic
1046695838 8:117338187-117338209 AGGTGTCATCACTTGGAAAAGGG + Intergenic
1047098441 8:121649573-121649595 AGGTGTCAATACCTGGGAAAAGG - Intergenic
1049002082 8:139832600-139832622 AGGTGTCATATTCTGGGGAAAGG + Intronic
1050562793 9:6851730-6851752 TCTTGTCTTCTCCTGGGAACAGG + Intronic
1051209468 9:14726483-14726505 ACGTGTCTTTTCCATGGAAAGGG - Intergenic
1051730343 9:20135835-20135857 ATGTGTCTTGTCTTTGGAAAAGG - Intergenic
1052182967 9:25553414-25553436 AAGTTTCTTCTCCCAGGAAATGG + Intergenic
1052834541 9:33240744-33240766 ATGTGTCCAGTCCTGGGAAAGGG - Intronic
1055209086 9:73767329-73767351 AAGTGTCTTCTCCTTAGAGAGGG - Intergenic
1056435320 9:86570217-86570239 AGGTGTTATCTGCTGGGAAGAGG + Intergenic
1056707024 9:88959964-88959986 AGGGGGCTGCTCCTGTGAAACGG + Intergenic
1056752249 9:89360860-89360882 TGGAGTGTTCTACTGGGAAATGG - Intronic
1059366234 9:113788457-113788479 AGGTTTCTGCTCCTGAGCAAGGG - Intergenic
1059412923 9:114144722-114144744 AGGTTTCTCCCCCTGGGAGAAGG + Intergenic
1060029324 9:120200797-120200819 AGATGTCCTCTACTGGGGAATGG - Intergenic
1060944973 9:127564956-127564978 AAGTGACTTCTTCTGGGAAGTGG + Intronic
1062331130 9:136045383-136045405 AGCTGTCCCCTGCTGGGAAAGGG + Intronic
1062654067 9:137593061-137593083 AGGTGCCTGCCCCTGGGAGAGGG - Intergenic
1186195678 X:7108511-7108533 AGGGGTCTTCTGCAGGGAAGAGG - Intronic
1186799817 X:13081572-13081594 AAATGTCTTCTACTGGGAGAAGG + Intergenic
1187433351 X:19244618-19244640 AGGGGACATCTTCTGGGAAAGGG + Intergenic
1188400189 X:29734855-29734877 AGGTGCTTTCCCCTGGGAATTGG - Intronic
1188513165 X:30958407-30958429 AGGTGTCTTCACATGGGAGAAGG - Intronic
1190187634 X:48249843-48249865 AGATGTCTTCGAATGGGAAAAGG + Intronic
1190656523 X:52617610-52617632 AGATGTCTTCGAGTGGGAAAAGG + Intergenic
1191817643 X:65265520-65265542 AGGTCTCATCTCATGAGAAAGGG + Intergenic
1194833189 X:98650503-98650525 AGGTGTCCTCATATGGGAAAAGG - Intergenic
1194935065 X:99938793-99938815 AAGAGACTTCTCCAGGGAAATGG + Intergenic
1196633269 X:117968122-117968144 AGGCGTCTTCTCATGTGACATGG - Intronic
1197011468 X:121569920-121569942 ACGTGGCTGCTGCTGGGAAATGG - Intergenic
1198257274 X:134934683-134934705 AGGTTTCTTCCCCTGTAAAATGG - Intergenic
1198720987 X:139620186-139620208 TGGTTTCTTTTTCTGGGAAATGG - Intronic
1199501900 X:148516350-148516372 AGGGGTGTTTTCCTGGGAAAAGG - Intronic
1199991702 X:152991076-152991098 AGGTCTCTTCGCCTGGGCTAGGG + Exonic