ID: 1142672944

View in Genome Browser
Species Human (GRCh38)
Location 17:1495796-1495818
Sequence GGATGGGAGTGAATCCCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 293}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142672944_1142672948 -7 Left 1142672944 17:1495796-1495818 CCGCCTGGGATTCACTCCCATCC 0: 1
1: 0
2: 1
3: 18
4: 293
Right 1142672948 17:1495812-1495834 CCCATCCTGGCTCAGATCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 216
1142672944_1142672952 12 Left 1142672944 17:1495796-1495818 CCGCCTGGGATTCACTCCCATCC 0: 1
1: 0
2: 1
3: 18
4: 293
Right 1142672952 17:1495831-1495853 GTGGCTGTGCTTCACCCAGTGGG 0: 1
1: 0
2: 0
3: 15
4: 161
1142672944_1142672951 11 Left 1142672944 17:1495796-1495818 CCGCCTGGGATTCACTCCCATCC 0: 1
1: 0
2: 1
3: 18
4: 293
Right 1142672951 17:1495830-1495852 TGTGGCTGTGCTTCACCCAGTGG 0: 1
1: 0
2: 1
3: 16
4: 194
1142672944_1142672953 25 Left 1142672944 17:1495796-1495818 CCGCCTGGGATTCACTCCCATCC 0: 1
1: 0
2: 1
3: 18
4: 293
Right 1142672953 17:1495844-1495866 ACCCAGTGGGTCCTCCCTCAAGG 0: 1
1: 1
2: 3
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142672944 Original CRISPR GGATGGGAGTGAATCCCAGG CGG (reversed) Exonic
900136913 1:1121652-1121674 GGAGGGGGGGCAATCCCAGGGGG - Intergenic
902043515 1:13509348-13509370 GCCTGGGAGTGTATCACAGGAGG - Intronic
902335495 1:15752081-15752103 GGGTGGTATTGAAGCCCAGGTGG + Intergenic
902703172 1:18186781-18186803 GGAGGGAAGAGAATTCCAGGGGG - Intronic
903395733 1:23000593-23000615 GAAATGGAGTGAATGCCAGGTGG + Intergenic
903789322 1:25881769-25881791 GTATGGGAGGTGATCCCAGGAGG - Intergenic
904537414 1:31208957-31208979 GGGTGGGAGTGGATCCAATGGGG + Intronic
904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG + Intergenic
904984629 1:34534793-34534815 AGAAGGGTGTGAATTCCAGGAGG - Intergenic
905853742 1:41293604-41293626 TGTTAGGAGTGAATCCCTGGGGG + Intergenic
906952066 1:50342970-50342992 GGATGTGAATGAAGCTCAGGAGG - Intergenic
907264277 1:53246973-53246995 GCATGGGACTGAATTCCATGAGG + Exonic
907309828 1:53532881-53532903 GGAAGGGAAGGAGTCCCAGGAGG - Intronic
907450164 1:54541240-54541262 AGAAGGAAGTGAATCCCCGGAGG - Intergenic
908784507 1:67721838-67721860 TGATGGGAAGGAATCCCAGTTGG - Intronic
909943223 1:81634622-81634644 GGCTGGGACTGGAACCCAGGAGG - Intronic
910244078 1:85120292-85120314 GGAAGGGAGTGGAACCCTGGAGG + Intronic
911148694 1:94576443-94576465 AGAGTGGAGTGAACCCCAGGGGG - Intergenic
914840347 1:151243121-151243143 CCATGGGTGTGAATACCAGGAGG + Intronic
915075991 1:153308401-153308423 GGGTGGGGAGGAATCCCAGGAGG - Intronic
915797436 1:158751996-158752018 GCATAGGAGGGAAGCCCAGGGGG - Intergenic
916804184 1:168242861-168242883 GGGTGCAAGTGATTCCCAGGTGG + Exonic
918387155 1:184021087-184021109 CTATAGGAGTGAATACCAGGAGG + Intronic
919093084 1:192997581-192997603 GGTTGGGAGAGAATCCCAACTGG + Intergenic
921097758 1:211901724-211901746 GCATGGGAGGGAAGCCTAGGTGG + Intergenic
922243927 1:223776590-223776612 GGGTGGGAGTGAAAGGCAGGAGG + Intergenic
1062947826 10:1474473-1474495 GGAGGGGGATGCATCCCAGGAGG + Intronic
1063132075 10:3187001-3187023 GGATGAGAGTCATTTCCAGGTGG - Intergenic
1063362237 10:5468192-5468214 GGAAGGGTGTGAATCCTGGGAGG - Intergenic
1064428058 10:15247520-15247542 ACAGGGGAGTGAATACCAGGAGG - Intronic
1065556109 10:26917193-26917215 GGATGGTAGGAAATTCCAGGTGG + Intergenic
1066568012 10:36740983-36741005 GGATAGTAGGGAATTCCAGGTGG - Intergenic
1067332846 10:45337866-45337888 GGTTGAGAGTGAAACCCATGAGG + Intergenic
1067478613 10:46581626-46581648 GGATGGGGGCCAATCCCAGGGGG + Intronic
1067616124 10:47760175-47760197 GGATGGGGGCCAATCCCAGGGGG - Intergenic
1068213519 10:53952762-53952784 GCATGGGAGAGAAGCCAAGGTGG - Intronic
1069543216 10:69311212-69311234 GGATGGGACTGAATTCCAAAAGG + Intronic
1069856011 10:71441365-71441387 GGAGGAGGGTGGATCCCAGGTGG - Intronic
1071497588 10:86179442-86179464 GGATGGAAGTGACTCCCTGCTGG - Intronic
1072270172 10:93768609-93768631 GGATGAGAGATAATCCCAGGAGG + Intronic
1072610480 10:97014322-97014344 GACTGTGAGTGAATCCCATGAGG - Intronic
1073014310 10:100385812-100385834 GAAATGGAGTGAATGCCAGGTGG - Intergenic
1073187301 10:101623950-101623972 GGATGGGTGTGACTACCAAGGGG + Intronic
1073778096 10:106808378-106808400 GCATGGGAGTGAGGGCCAGGAGG - Intronic
1074531834 10:114303718-114303740 GGGTGGGAGTGGATCGGAGGGGG - Intronic
1074760559 10:116664496-116664518 GGATGGGAGTAAAAACCAGCAGG - Intronic
1074941360 10:118238808-118238830 GGATGGGAGTGGTTCACAGATGG - Intergenic
1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG + Intergenic
1075938761 10:126369803-126369825 ATATGAGAGTGAATACCAGGAGG - Intronic
1077678566 11:4219288-4219310 GGACGCGAGTGAAACCCAGCAGG - Intergenic
1077687968 11:4315691-4315713 GGACGCGAGTGAAACCCAGCAGG - Intergenic
1077738823 11:4821811-4821833 GGATGGTAGTGTATCTCAGTGGG - Exonic
1077751330 11:4973473-4973495 GGATGGAAGTGTATCTCAGGGGG + Intronic
1078928814 11:15897658-15897680 ACAAGGGAGTGTATCCCAGGAGG - Intergenic
1080102785 11:28478672-28478694 GGAGGTGAATGAATACCAGGTGG - Intergenic
1081758757 11:45562442-45562464 GATGGGGAGGGAATCCCAGGTGG - Intergenic
1083134967 11:60664064-60664086 GGATGGGAGTGATAGCCAAGGGG - Intergenic
1084155329 11:67309974-67309996 GGATGGGAGCGAGTGGCAGGGGG + Intronic
1084218152 11:67662737-67662759 GGATGTGAGAGGATCCCTGGGGG + Exonic
1084725802 11:70941015-70941037 TTATGGGTTTGAATCCCAGGAGG + Intronic
1085034887 11:73293755-73293777 GGAGGGGAGGGGGTCCCAGGAGG + Intronic
1085414735 11:76312494-76312516 GGCTGGGTGTAAAGCCCAGGGGG + Intergenic
1085868269 11:80320341-80320363 AGGTGGGACTGAATGCCAGGTGG + Intergenic
1086819026 11:91412079-91412101 GGAATGGCGTGAACCCCAGGGGG - Intergenic
1089591842 11:119546745-119546767 GCATGGGAGGGAAGCCAAGGGGG + Intergenic
1090383571 11:126343643-126343665 GGGTGGAAGTGCATCCCAGATGG - Intronic
1090475258 11:127014357-127014379 GGCTGGGAGAGAAACCCACGTGG + Intergenic
1090990103 11:131809504-131809526 GCATGGGAGAGAATGACAGGCGG + Intronic
1093862596 12:24185320-24185342 GGATTGGAGTGCATCTGAGGTGG - Intergenic
1093966422 12:25331734-25331756 AGGTGAGAGTGAATCCCAGGAGG - Intergenic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1095784804 12:46098300-46098322 AGAATGGAGTGAAACCCAGGAGG + Intergenic
1098243894 12:68496371-68496393 GGAAGGGAATGAAGCCCAAGTGG - Intergenic
1098988641 12:77040681-77040703 GGATGGGAGTGGGGACCAGGAGG + Intronic
1101637497 12:106557265-106557287 GGCTGAGACTGAATCCCACGTGG - Intronic
1102226756 12:111234266-111234288 GAATGGGAATGAAACCCAAGAGG + Intronic
1104060201 12:125261381-125261403 GGATGGGACTGTGTACCAGGTGG + Intronic
1104757752 12:131279505-131279527 TGATGGAAGTGACTCCCAGCAGG - Intergenic
1106432804 13:29697397-29697419 ACATGGGAGTGAGTTCCAGGAGG - Intergenic
1106469680 13:30043299-30043321 AGAAGGGTGTGAATGCCAGGAGG - Intergenic
1106845478 13:33733815-33733837 GGATGGGAGTGAGACCGAAGTGG + Intergenic
1107444394 13:40457361-40457383 GGATGGAACTGAATGCCAGAAGG - Intergenic
1108063511 13:46554344-46554366 GGCTTGTAGTGAATCCCAGTCGG + Intronic
1108151713 13:47542785-47542807 GGATGGGGGTGAATCTCAGAAGG - Intergenic
1108359080 13:49652740-49652762 GGAAGGGAGTGAGTCACTGGAGG + Intergenic
1108525308 13:51281039-51281061 GAAAGGGAGGGAAGCCCAGGAGG - Exonic
1110567562 13:76971595-76971617 GGATGTGAGTAAATCCTATGGGG - Intergenic
1114006283 14:18317070-18317092 GGATGGTAGGAAATTCCAGGTGG - Intergenic
1115484965 14:33901609-33901631 GCATGGGAGGGAAGCCTAGGGGG + Intergenic
1115849901 14:37583435-37583457 GGATGGCGGTGAAACCCGGGAGG + Intergenic
1116865135 14:50025669-50025691 GCAAGGGTGTGAATTCCAGGAGG - Intergenic
1116927060 14:50650485-50650507 ACAAGGGTGTGAATCCCAGGAGG - Intronic
1117651012 14:57905433-57905455 GCAAGGGTGTGAATACCAGGAGG + Intronic
1117944325 14:61001434-61001456 GGATGGGTGTGAATCTCTGCAGG + Intronic
1119597269 14:75946870-75946892 GGATGGAAGGGAACTCCAGGTGG + Intronic
1120901210 14:89577169-89577191 GGGTGCGAGTGAATGCCTGGAGG + Intronic
1121193004 14:92046367-92046389 GAAATGGAGTGAATGCCAGGTGG + Exonic
1121312224 14:92941370-92941392 GGATGGAAGAGAGTACCAGGTGG - Exonic
1121407882 14:93729861-93729883 GGAAGGGAGAGAATGGCAGGAGG + Intronic
1121647110 14:95526034-95526056 GGATGAGGGAGAGTCCCAGGAGG - Intergenic
1122429603 14:101631988-101632010 AGGTGGGAGAGAATCCCAGTAGG - Intergenic
1123390209 15:19863732-19863754 GGATGGTAGGAAATTCCAGGTGG - Intergenic
1131399717 15:92114566-92114588 GCATGGGTGTGAATCCAAGGTGG - Intronic
1131451208 15:92541668-92541690 GGGTTGGAGTGGGTCCCAGGAGG - Intergenic
1131743150 15:95416354-95416376 GGATCCCAGTGAATGCCAGGAGG + Intergenic
1132043781 15:98547773-98547795 GGATGGGGGGGAATGCGAGGGGG - Intergenic
1132295475 15:100731146-100731168 GAATGGAAGTGAAACCCTGGGGG + Intergenic
1132870997 16:2115734-2115756 GGCTGGGAGTGCTGCCCAGGTGG - Intronic
1133150876 16:3828713-3828735 GGCTTGGAGTCAATCACAGGTGG + Intronic
1135281863 16:21159321-21159343 GGAAGGGAGTGAAATGCAGGTGG - Exonic
1136530219 16:30863112-30863134 GAAGTGGAGTGAATGCCAGGTGG - Intronic
1138326202 16:56171424-56171446 GAATGACAGTGAAGCCCAGGTGG - Intergenic
1139504802 16:67393489-67393511 GGGTGGGACTGCAGCCCAGGCGG + Intronic
1140016935 16:71196626-71196648 GGCTGGGAATGAAGCCTAGGAGG - Intronic
1141133850 16:81453145-81453167 GTCTGGGTTTGAATCCCAGGTGG - Intronic
1142227971 16:88886624-88886646 AGCTGGGAGTGAAACCCAGCTGG + Intronic
1142672944 17:1495796-1495818 GGATGGGAGTGAATCCCAGGCGG - Exonic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143086790 17:4422098-4422120 GGAAGGGCATGAATACCAGGAGG - Intergenic
1143210037 17:5179237-5179259 GGATGTGAGCGCATCCCAGGGGG - Intergenic
1143562274 17:7703168-7703190 GGAGGGAGGTGAATCCCAGAGGG + Intronic
1144362318 17:14507285-14507307 GGGTGGGAGTGAACTCCAAGGGG + Intergenic
1144504467 17:15818191-15818213 GGATGTGAGCGCATCCCACGGGG + Intergenic
1144634221 17:16893861-16893883 GGATGTGAGCGCATCCCACGGGG + Intergenic
1145168318 17:20633705-20633727 GGATGTGAGCGCATCCCACGGGG + Intergenic
1145200287 17:20938669-20938691 GGATGCGAGCGCATCCCACGGGG + Intergenic
1146164411 17:30576670-30576692 GGATGTGAGCGCATCCCACGGGG + Intergenic
1148444726 17:47730733-47730755 GGAAGTGAGGGGATCCCAGGGGG + Intergenic
1150713296 17:67549719-67549741 GGATTGGAGTGAATTTGAGGAGG + Intronic
1150767277 17:68012148-68012170 AGATGGGAGGTAAGCCCAGGAGG + Intergenic
1151684022 17:75636405-75636427 GGAAGGCAGGGAAGCCCAGGAGG - Intronic
1152261567 17:79270037-79270059 GGAAGGGAGTGATTCGCAGAGGG - Intronic
1152635585 17:81429366-81429388 GGAGGGGAGGGGATCCCGGGGGG - Intronic
1152795841 17:82305789-82305811 GGATGGCCCTGAATCCCACGCGG + Intergenic
1152936565 17:83140686-83140708 AAAAGGGAGTGAATACCAGGAGG + Intergenic
1154106043 18:11523881-11523903 GGAAGGGAGTGAATCACACCAGG - Intergenic
1154502453 18:15003571-15003593 GGATGTGACTGAGGCCCAGGAGG - Intergenic
1158401593 18:57126447-57126469 GGATGGGAAAGAAGCTCAGGTGG + Intergenic
1158576546 18:58643512-58643534 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1161115233 19:2493051-2493073 AGATGGGAGTGAGGCCCTGGGGG + Intergenic
1162348941 19:10137378-10137400 CGATGGGCGTGAGCCCCAGGGGG - Intronic
1162573171 19:11483984-11484006 GGGTGGGAGGGGATCCCAGCAGG - Intronic
1163466151 19:17469733-17469755 GGGCCGGAGTGAAACCCAGGAGG + Intronic
1163495014 19:17641305-17641327 GGGTGGGAGGGATTCTCAGGGGG - Intronic
1164003773 19:21131174-21131196 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1164536024 19:29087243-29087265 GGGTGGGAGGTGATCCCAGGAGG + Intergenic
1165330808 19:35140340-35140362 GGATGGGGCTGAATCCCCGATGG + Intronic
1165705071 19:37969950-37969972 GGCTGGCTGTGAGTCCCAGGAGG + Intronic
1166561557 19:43735992-43736014 AGATGTGAATGAATCCCAGATGG + Intronic
1167383146 19:49149948-49149970 GGAAGGGAGGGAAACCCATGTGG + Intronic
925412104 2:3645692-3645714 ACATGGGGGTGAATACCAGGGGG + Intergenic
927753264 2:25688606-25688628 AGAATGGAGTGAACCCCAGGGGG - Intergenic
928690560 2:33794326-33794348 GGAAGGGATTGAATTTCAGGTGG + Intergenic
931200554 2:60093319-60093341 GCATGGGAGAGGATGCCAGGAGG + Intergenic
932112203 2:69011990-69012012 GAAGGGGTGTGAATTCCAGGAGG + Intergenic
937087572 2:119181522-119181544 AGAAGGGAGTGACTCCCAGTTGG - Intergenic
938501628 2:131833743-131833765 GGATGTGACTGAGGCCCAGGAGG - Intergenic
939377254 2:141384719-141384741 GGATGGGAGTGGGTTTCAGGAGG - Intronic
939552356 2:143630984-143631006 GGATGGGAGTGCAGAGCAGGTGG - Intronic
940218472 2:151325520-151325542 GGATGTGAATGAATACCAGGAGG + Intergenic
943143687 2:184015647-184015669 GGATTGGAGTGAAGTACAGGTGG - Intergenic
943456972 2:188120423-188120445 GGAATGGCGTGAACCCCAGGGGG - Intergenic
946309833 2:218877367-218877389 GGGTGGGAGTGATTACCAGAAGG + Intergenic
947874819 2:233461160-233461182 GGCTGGGAGGGACTCACAGGCGG - Intronic
1168773129 20:428702-428724 GGATGGGAGTGACAGCCAGAAGG - Intronic
1169518014 20:6338974-6338996 GGATGCTAGTGAGTCCCATGAGG + Intergenic
1169813415 20:9631553-9631575 AGATGGGAATGAAGCCCAGCTGG + Intronic
1171049306 20:21840457-21840479 GTATGGGAGGTGATCCCAGGAGG - Intergenic
1175321472 20:58091202-58091224 GGAAGGGAGGGAAAGCCAGGTGG - Intergenic
1175350675 20:58315746-58315768 GGATGGGAAGGAGTCCCAGAGGG - Intronic
1176067213 20:63204341-63204363 GTATGGGAGAGTGTCCCAGGAGG - Intronic
1176766220 21:13021346-13021368 GGATGGTAGGAAATTCCAGGTGG - Intergenic
1178914546 21:36699258-36699280 GGAGGGGAGCGAGTCGCAGGCGG - Exonic
1178947343 21:36959356-36959378 GGATGGGAGGGAGGCCGAGGAGG + Intronic
1179288166 21:39995884-39995906 GGATTTGAATGAATCCCAAGTGG + Intergenic
1180430794 22:15247883-15247905 GGATGGTAGGAAATTCCAGGTGG - Intergenic
1180513348 22:16115788-16115810 GGATGGTAGGAAATTCCAGGTGG - Intergenic
1180799172 22:18623842-18623864 GGAGGGAAGGGAATTCCAGGCGG - Intergenic
1181222546 22:21371424-21371446 GGAGGGAAGGGAATTCCAGGCGG + Intergenic
1182060204 22:27391761-27391783 GGGTGGGAGGGAATGCAAGGTGG + Intergenic
1182236369 22:28880052-28880074 GGATAGGAGTGGATGACAGGGGG + Intergenic
1183024998 22:35058371-35058393 GCATGGGAGGGAAGCCGAGGAGG - Intergenic
1183345365 22:37304490-37304512 GGAGGGGATTGAAGCTCAGGGGG - Intronic
1183636519 22:39066701-39066723 GAAATGGAGTGAATGCCAGGTGG + Intronic
1183647762 22:39136325-39136347 GCATAGGTGTGAATTCCAGGAGG - Intronic
1183781731 22:40003282-40003304 GGAGGGGCGTAAGTCCCAGGGGG - Intronic
1183938726 22:41280277-41280299 GGTTGGGCCAGAATCCCAGGAGG + Intronic
1185051970 22:48558854-48558876 GGAGGCAAGTGAAGCCCAGGAGG - Intronic
1185264733 22:49894980-49895002 ATGTGGGAGTGAAGCCCAGGAGG + Intergenic
1185382116 22:50514306-50514328 GGAGGGGAGTGAAGGGCAGGAGG + Intronic
950271650 3:11620744-11620766 GGAGGGGATGGAATTCCAGGTGG - Intronic
951679916 3:25283885-25283907 TCAAGGGAGTGAATGCCAGGAGG - Intronic
953099512 3:39810546-39810568 GGTAGGGAGCCAATCCCAGGGGG + Intronic
953361593 3:42301872-42301894 TGATGGGAGTGGAACCCAGATGG + Intergenic
953496442 3:43391503-43391525 ACAAAGGAGTGAATCCCAGGAGG - Intronic
953584457 3:44187106-44187128 GCAAGGGTGTGAATACCAGGAGG - Intergenic
953772617 3:45790602-45790624 AGATGGGAGGGAATTCTAGGAGG - Intronic
954086146 3:48245500-48245522 GGAAGGGAGTGCCTCTCAGGGGG - Intronic
954698861 3:52441457-52441479 GGATGGGAGTAGAACCCAGTGGG + Intronic
955450259 3:59058546-59058568 GGATGGAACTGGAACCCAGGAGG + Intergenic
955489680 3:59469827-59469849 GGTTGGGAGTGAGTTTCAGGAGG + Intergenic
958180486 3:90053692-90053714 GGATTGGAGAGAATCGCAGCAGG + Intergenic
960136470 3:114110701-114110723 GCCTGGGAGAGAAACCCAGGGGG + Intergenic
961155785 3:124678342-124678364 GGGTGGGAGTGGATGACAGGTGG - Intronic
961238213 3:125386958-125386980 AAAAGGGAGTGAATACCAGGAGG + Intergenic
962021966 3:131511195-131511217 GAAATGGAGTGAATGCCAGGTGG + Intergenic
963841075 3:150107089-150107111 TGATGAGAATGAATCCCTGGGGG + Intergenic
968780275 4:2575228-2575250 CGGTGGAAGAGAATCCCAGGTGG + Intronic
969585212 4:8087582-8087604 TGAGGGGAGTGAATGCCAGAGGG + Intronic
970227874 4:13878746-13878768 GGATGGGAATGAATGGCAAGGGG - Intergenic
970766553 4:19556311-19556333 GGATGGGAGTGAGTTTCAGGAGG - Intergenic
971315797 4:25566965-25566987 GGAATGGCGTGAACCCCAGGGGG - Intergenic
972573924 4:40334729-40334751 GGCTGGCAGTCAAACCCAGGTGG + Intergenic
973632813 4:52835175-52835197 GGACGCGAGTGAAAGCCAGGAGG + Intergenic
974173173 4:58293126-58293148 GAAATGGAGTGAATGCCAGGTGG + Intergenic
977060822 4:92255124-92255146 GGTTGGGACAGAATCCCTGGTGG + Intergenic
982127432 4:152196585-152196607 GCAAGGGAGTGAATCTGAGGAGG - Intergenic
984849193 4:184139068-184139090 GGATGGGACTGCAACCCAAGTGG + Intronic
986760925 5:10878967-10878989 GGATGGGAGTGTAGCCCACAAGG - Intergenic
989197951 5:38734219-38734241 GGATGGAGGTGAATACCAGCAGG - Intergenic
989619426 5:43369794-43369816 GGAAGGGACTGTATACCAGGAGG - Intergenic
995742378 5:115368685-115368707 GCATGGGAGGGAAGCCGAGGAGG + Intergenic
996052350 5:118948544-118948566 GAAATGGAGTGAATGCCAGGTGG + Intronic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
999223314 5:149999701-149999723 GGCTGGGATTCAAACCCAGGAGG + Intronic
999258472 5:150222927-150222949 GGATGGGAGTGTTGCCCTGGAGG - Intronic
1002019559 5:176354284-176354306 GCCTGGGTGTGAGTCCCAGGTGG - Intronic
1003322855 6:5067622-5067644 GGAAGGGTGTGAACACCAGGAGG + Intergenic
1004998696 6:21218853-21218875 ATATGGGTGTGAATACCAGGAGG + Intronic
1006596018 6:35192863-35192885 GGATGGGACTGGAGGCCAGGAGG - Intergenic
1007130657 6:39470523-39470545 GGATGCCTGTGAAACCCAGGAGG + Intronic
1007180526 6:39926190-39926212 GGATGGGTGACAATGCCAGGAGG - Intronic
1007429346 6:41767731-41767753 GGGTGGGAGCGATGCCCAGGAGG - Intergenic
1007629994 6:43268146-43268168 GGATGGCATTGAATCCCAGAGGG - Intronic
1008874388 6:56309575-56309597 GGATGTGAGGTACTCCCAGGGGG + Intronic
1011188735 6:84708071-84708093 GGCTGGGATTCAGTCCCAGGTGG - Intronic
1011739854 6:90348837-90348859 GGATTGTAGTGAATTACAGGAGG + Intergenic
1013173896 6:107661478-107661500 GAATGGGATTCAAGCCCAGGAGG + Intergenic
1013286823 6:108689272-108689294 GGATGGGAGGGAGGCTCAGGAGG + Intergenic
1014166816 6:118234220-118234242 ATAAGGGAGTGAATACCAGGAGG - Intronic
1014923328 6:127239418-127239440 GCATGGGAGTGGATCCTATGAGG - Intergenic
1015385461 6:132617914-132617936 GCATGATGGTGAATCCCAGGAGG + Exonic
1017270095 6:152494386-152494408 GAAATGGAGTGAATGCCAGGTGG - Intronic
1021657208 7:22883867-22883889 AGATGGGAGTGAAGTCCATGTGG - Intergenic
1022447665 7:30483128-30483150 GAAATGGAGTGAATGCCAGGTGG - Intergenic
1023702442 7:42905835-42905857 GTATGGGACTGAAGCCCATGGGG - Intergenic
1023739164 7:43262851-43262873 GGATGTGATTGAATGGCAGGAGG - Intronic
1023745651 7:43320158-43320180 GGATGGTGGTGATGCCCAGGTGG + Intronic
1024004018 7:45212210-45212232 AGTTGGGAGAGAACCCCAGGCGG + Intergenic
1026621267 7:71951953-71951975 GGTTGGGTCTGACTCCCAGGAGG - Intronic
1027957387 7:84898518-84898540 GGAGGAGTGTGAATACCAGGAGG - Intergenic
1028383832 7:90229967-90229989 GGATAGAAGTGACTGCCAGGAGG - Exonic
1029514642 7:101017765-101017787 GGAAGGGAGGGAGTCCCAGGGGG - Intronic
1029514684 7:101017854-101017876 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514705 7:101017895-101017917 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514726 7:101017936-101017958 GGGAGGGAGGGAATCCCAGGGGG - Intronic
1029514747 7:101017977-101017999 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514768 7:101018018-101018040 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514789 7:101018059-101018081 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514832 7:101018141-101018163 GGAGGGGAGGGAGTCCCAGGGGG - Intronic
1029514854 7:101018183-101018205 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1029514978 7:101018471-101018493 GGGAGGGAGGGAGTCCCAGGGGG - Intronic
1030449857 7:109694551-109694573 GGATGAGAATGAATCACAGTTGG - Intergenic
1030973084 7:116086228-116086250 GGATTGGAGTGAATTCTGGGAGG - Intronic
1032109069 7:129059920-129059942 GTGTGGGACTGAAGCCCAGGGGG + Intergenic
1033611840 7:142970715-142970737 GGATAGGAGTGACTCCCACACGG - Intergenic
1034365058 7:150539273-150539295 TCATGGGAGTGAATCCCTTGTGG - Intergenic
1034718103 7:153262336-153262358 GGCTGGAAGGGAATCCCAGGGGG + Intergenic
1036046190 8:5143638-5143660 TGATGGCAGTGAGGCCCAGGGGG - Intergenic
1036229823 8:6990226-6990248 GGTTGAGACTGAATCCCACGTGG + Intergenic
1036232274 8:7009329-7009351 GGTTGAGACTGAATCCCACGTGG + Intronic
1038239774 8:25797747-25797769 GGATGGGAGGGCATTGCAGGAGG + Intergenic
1038548369 8:28443655-28443677 GTCTGGGAGTGAAGCCCAGTAGG - Intronic
1039182362 8:34880666-34880688 GCATGGGAGAGAAGCCGAGGGGG - Intergenic
1039255683 8:35716468-35716490 GCATGGGATTGAGTCCCAGTTGG + Intronic
1039916722 8:41865611-41865633 GGAGGGGAGAGAATCAGAGGAGG - Intronic
1040452439 8:47561665-47561687 AGATGGGGGAGGATCCCAGGAGG - Intronic
1044191696 8:89326574-89326596 GTCTGGGAGTTAATCCCAGGAGG - Intergenic
1044774999 8:95678399-95678421 GCATGGGAGTGAGGCCGAGGGGG - Intergenic
1046501668 8:115085723-115085745 GGATTGGAGAGACTGCCAGGGGG - Intergenic
1046626150 8:116578734-116578756 GGATGGGAAAGATTCCCAGAGGG + Intergenic
1047066048 8:121284335-121284357 GGAAAGGAGTGCATCCCTGGAGG + Intergenic
1047591488 8:126331705-126331727 GGAGGGGAGTGATCCCCAGCTGG + Intergenic
1048190420 8:132283008-132283030 GGCTGGGAGGGAATCACAGATGG + Intronic
1049285807 8:141774623-141774645 GCATGGGAGTGAATCCCGGGAGG + Intergenic
1049643285 8:143725120-143725142 GAAAGGAAGTGAAGCCCAGGCGG + Exonic
1050313461 9:4376967-4376989 GGCTGGGAGGCAATCTCAGGTGG - Intergenic
1053708893 9:40784851-40784873 GGATGGTAGGAAATTCCAGGTGG + Intergenic
1054418803 9:64905648-64905670 GGATGGTAGGAAATTCCAGGTGG + Intergenic
1055152709 9:73022033-73022055 TGACTGGAGTGAATCCCATGGGG + Intronic
1056381079 9:86057758-86057780 GGATGTGACTGAGGCCCAGGAGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1058733503 9:107873293-107873315 GGGTGGGAGTGAGGCACAGGTGG - Intergenic
1058781410 9:108339765-108339787 GGAAGGGAGTGATTTCCAGAGGG - Intergenic
1059602822 9:115799811-115799833 GGAAAGGAGTGGATACCAGGTGG + Intergenic
1060468903 9:123930861-123930883 TCATGGAAGTGAATCCCAAGGGG - Intergenic
1061653100 9:132066913-132066935 GCCTGGGAGTGAGTGCCAGGAGG - Intronic
1062480648 9:136749295-136749317 GTGTGGGAGTGAATCCCAGAGGG - Intergenic
1062498045 9:136840806-136840828 GGATGTGACTGAGGCCCAGGAGG + Exonic
1186381098 X:9060070-9060092 CGATAGGAGTGGATCACAGGTGG - Intronic
1186836708 X:13445607-13445629 ACAAGGGTGTGAATCCCAGGAGG + Intergenic
1189343450 X:40222135-40222157 GTATGGGCATGAATTCCAGGAGG - Intergenic
1190152321 X:47958583-47958605 AGCTGGGAGTGACCCCCAGGAGG - Intronic
1190160341 X:48027545-48027567 AGCTGAGAGTGACTCCCAGGAGG + Intronic
1190250829 X:48723918-48723940 TCATGGGAGTATATCCCAGGAGG - Intergenic
1191805530 X:65131322-65131344 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1195016813 X:100789062-100789084 GAAATGGAGTGAATGCCAGGTGG + Intergenic
1196856877 X:119992522-119992544 GGATGTGAGTGAAGCCGAAGTGG + Intergenic
1197693019 X:129523029-129523051 GGAGGGGAGCGAACGCCAGGCGG + Intronic
1198674070 X:139113199-139113221 GAATGCGACTGAATCCCACGAGG - Intronic
1199074114 X:143510507-143510529 GGATGGGAGTGAATACTCTGGGG - Intronic
1201773735 Y:17642965-17642987 GGTTGTGAGTGATTACCAGGAGG - Intergenic
1201827821 Y:18263020-18263042 GGTTGTGAGTGATTACCAGGAGG + Intergenic