ID: 1142673384

View in Genome Browser
Species Human (GRCh38)
Location 17:1497979-1498001
Sequence TACAGCAGCCACATGACGTA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673384_1142673396 29 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673396 17:1498031-1498053 CCGGCGGTATGGGAGTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1142673384_1142673392 19 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673384_1142673389 10 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673389 17:1498012-1498034 GACAAGGAGAAGTGTGACGCCGG 0: 1
1: 0
2: 2
3: 12
4: 134
1142673384_1142673391 18 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673384_1142673394 28 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673384_1142673385 -6 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673385 17:1497996-1498018 GCTGTAGCCCCTCAGAGACAAGG 0: 1
1: 0
2: 1
3: 16
4: 152
1142673384_1142673393 27 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673384_1142673390 13 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673390 17:1498015-1498037 AAGGAGAAGTGTGACGCCGGCGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673384 Original CRISPR TACAGCAGCCACATGACGTA CGG (reversed) Exonic
902470216 1:16643790-16643812 TGCAGCAGCAACATGATGTGAGG - Intergenic
904280977 1:29418040-29418062 CACAGCAGCCCCATGAAGCAAGG - Intergenic
911076128 1:93877433-93877455 TACAGGAGCCAGAAGAAGTAAGG - Exonic
913097180 1:115529568-115529590 GACAGCAGTCACAGGAGGTAAGG + Intergenic
915050084 1:153059624-153059646 CAGAGCAGCCACATGAGGAACGG + Intergenic
917790898 1:178498034-178498056 CACAGCAACCACATGACGTGAGG + Intergenic
918778557 1:188668177-188668199 TACAACAGCCCCATCAAGTATGG + Intergenic
919148115 1:193660613-193660635 GACAGCAGACACATGACACAAGG - Intergenic
919428029 1:197458276-197458298 TACAGCAGCCACAGGAGTTTAGG + Intronic
919456509 1:197826877-197826899 TACAGCAGCCATAGGAAATAAGG - Intergenic
920033418 1:203050532-203050554 TACAGCAAGCACATGACCAAAGG - Intronic
920043213 1:203117231-203117253 TAGAGCAGCCAGATGAAGTGGGG + Intronic
923684266 1:236142953-236142975 TAGAGCAGCCAGAAGACGAAGGG - Exonic
1063860232 10:10299281-10299303 TACCACAGCCACAAGATGTAAGG - Intergenic
1067086107 10:43239105-43239127 TGCAGCTGCCACAGAACGTATGG - Intronic
1070544863 10:77444412-77444434 TGTAGCAGCCAGATGAAGTACGG + Intronic
1072991956 10:100204511-100204533 TACAGCGAGCAGATGACGTATGG - Exonic
1082090538 11:48085840-48085862 TACAGAAACCACCTGACATAGGG - Intronic
1084944149 11:72629847-72629869 TACAGCACCCCCATGAGGTAGGG - Intronic
1094028575 12:25985272-25985294 TACAGTAACAACATGACATAGGG - Intronic
1094278228 12:28704484-28704506 TTCAGCAGTCACATGACCTTAGG + Intergenic
1095568636 12:43656449-43656471 TATAGCAGCCAAATGAACTAAGG - Intergenic
1096753569 12:53780086-53780108 TAGAGCAGTCACAAGAAGTAAGG + Intergenic
1101645969 12:106631326-106631348 TCCAGCACCCACATGTGGTAGGG - Intronic
1105009783 12:132747911-132747933 TACATCAGCCTCATGAAGTCAGG + Exonic
1105627224 13:22124528-22124550 TTCAGCAGCCACATGAGATGTGG + Intergenic
1108015557 13:46071808-46071830 CACAGCTGACACATGACCTAAGG - Intronic
1108023192 13:46150435-46150457 TACAACAACCCCATGAGGTAAGG - Intronic
1115408331 14:33044851-33044873 TACAGTAGCCACAGGAAGTTTGG + Intronic
1115787473 14:36842502-36842524 TACAGAAGCCATAAGACGGAAGG + Intronic
1119792505 14:77365163-77365185 TACAGCAACCACATGAAAAAGGG + Intronic
1120187042 14:81404238-81404260 TACAGCAGACACTAGACATAGGG + Intronic
1120930462 14:89842727-89842749 GACAGCAGCCACATCACGAAGGG - Intronic
1126537042 15:49777787-49777809 GACAGCAGCCTGATGACGGAGGG + Intergenic
1131642500 15:94307531-94307553 AACAGAAGCCACATCATGTAGGG + Intronic
1133367582 16:5222971-5222993 TACAGAAGCCACATGTCCTAAGG + Intergenic
1134182740 16:12060985-12061007 GACAGCAGCCACCTGACCTAGGG - Intronic
1137858590 16:51822163-51822185 CACAGCAGCCACATAACTCAGGG - Intergenic
1138427738 16:56947419-56947441 GACACCACCCACATGACGCAGGG + Intergenic
1139342043 16:66273799-66273821 TACAGCATCCACTTCATGTATGG - Intergenic
1142299564 16:89248420-89248442 CACAGAAGCCACAGCACGTAGGG - Intergenic
1142673384 17:1497979-1498001 TACAGCAGCCACATGACGTACGG - Exonic
1142933820 17:3310713-3310735 TACAGCAGCCGCATGAGCTGGGG + Intergenic
1144739709 17:17575006-17575028 TACAGCAGCCACAGGAAGCGAGG - Intronic
1146903925 17:36606024-36606046 AACAAGAGCCACATGAGGTATGG - Intronic
1150188628 17:63214241-63214263 TATAGCATGCACATGAGGTAAGG + Intronic
1157176087 18:45453719-45453741 CACTGCATCCACATGAGGTAGGG + Intronic
1168637794 19:58009867-58009889 CACTGTAGCCACATGACCTAGGG - Exonic
941735756 2:168974286-168974308 TACACCATACACATGACGGACGG - Intronic
944716345 2:202378826-202378848 TACAGGAACCACATGGCTTATGG - Intronic
946585915 2:221187501-221187523 GTCAGCAGCCACATGATGTTAGG + Intergenic
948176928 2:235950672-235950694 TCCAGCAGCCACAGGAGGTCAGG + Intronic
1172178784 20:32988109-32988131 CACAGCAGCCCTATGACGTGGGG - Intronic
1176898954 21:14417024-14417046 TACAGCAGCAACATGACCCCAGG - Intergenic
1179256508 21:39720971-39720993 TCCACCAGCCACGTGACATAAGG - Intergenic
1180207068 21:46267448-46267470 TGCAGCATCCACATGACAAAAGG + Intronic
1183716518 22:39536347-39536369 CACAGCAGCCTTATGAGGTAGGG - Intergenic
954299212 3:49690463-49690485 TGCAGCAGCAACATGATGTGAGG + Intronic
960997472 3:123349567-123349589 TTCACCAGCCACATCACATATGG + Intronic
962937099 3:140091125-140091147 TACAGCAGCTTCATGAGGTTGGG - Intronic
963969374 3:151412939-151412961 TACAGCAAGCACATGACTTAAGG - Intronic
977312156 4:95400935-95400957 TACAGCTGCCAAATCACATATGG + Intronic
977798892 4:101201665-101201687 CACAGTAGCCACATGAAATATGG - Intronic
979522830 4:121688265-121688287 TACAGCAGCCCAATGAACTAAGG + Intronic
983873290 4:172847127-172847149 TAAAGCAGCCACTTGACCTATGG + Intronic
989698478 5:44233131-44233153 TAGAGCAGCCATATGACTTGTGG - Intergenic
994143879 5:96371322-96371344 TACAGCATCTACATGAGGTGGGG - Intergenic
996807774 5:127476743-127476765 TACAGCAGCCATTTTTCGTAGGG + Intergenic
1002883855 6:1276363-1276385 TACAGCAGCCACTAGACAGATGG + Intergenic
1005799429 6:29405487-29405509 TACAGAAGCCAGATTACGAATGG + Intronic
1007227200 6:40323453-40323475 TACAACAGCCACATGAGGTGAGG + Intergenic
1010783589 6:79973502-79973524 TACAGCATACACATGTTGTAAGG + Intergenic
1013157681 6:107509064-107509086 CACAACAACCACATGAGGTAGGG - Intronic
1021643018 7:22758752-22758774 AACAGTATCCACATGACATAAGG + Intergenic
1024499509 7:50089270-50089292 TGCAGTAGTCACATGAAGTATGG - Intronic
1030276456 7:107726719-107726741 TACAGCATCCACATGAAATTGGG + Intergenic
1031675033 7:124599567-124599589 TAGAGCAGCCACAAGTCATATGG + Intergenic
1032160878 7:129509379-129509401 TAAAACAGCCCCATGAGGTACGG - Intronic
1032725706 7:134588488-134588510 TACAGCAGGAACATGTCCTAAGG + Intergenic
1042184085 8:66120057-66120079 TTCAGCAGCCACGTGACTCAGGG + Intergenic
1043766821 8:84145924-84145946 TGCAGAGGCCACATGACTTAAGG - Intergenic
1045057589 8:98382743-98382765 TCCAGCGGCCACATGACTGAGGG + Intergenic
1045390186 8:101707441-101707463 TACAGCAGCCAGATGAGGATGGG - Intronic
1046041157 8:108906506-108906528 GACAGCAGCCACATAACCTGAGG - Intergenic
1046076848 8:109322689-109322711 TACAGCGGCCACAGGAGATAGGG + Intronic
1048255140 8:132900025-132900047 TACAACAGCCTCATGAGGCATGG - Intronic
1049853281 8:144845871-144845893 CTCAGCAGCCACGTGACGCAAGG - Intronic
1052466224 9:28833174-28833196 TAAAGCAGGCACATGACTTAGGG + Intergenic
1055855948 9:80688787-80688809 GACAGCAGCCAGATGATGAAGGG - Intergenic
1059389999 9:113993129-113993151 TACAGCAGCCCCAAGAAGGAAGG + Intronic
1061083542 9:128386226-128386248 TCGAGCAGCCACAAGATGTATGG + Intronic
1188007919 X:25029699-25029721 TACTGCAGCCATATGAGATATGG + Intergenic
1192171264 X:68856542-68856564 CACAACAGCCACATGAGGAAGGG + Intergenic
1193377269 X:80776655-80776677 TACAACTGCCACATGACCTTAGG - Intronic
1194592994 X:95823124-95823146 TACAGAAGCCACATGGAGTGAGG + Intergenic
1196165122 X:112530339-112530361 TACAGCACACACTTGACATAAGG - Intergenic
1200663592 Y:5991925-5991947 TGCAGCAGCAACATGTCTTAAGG + Intergenic