ID: 1142673386

View in Genome Browser
Species Human (GRCh38)
Location 17:1498003-1498025
Sequence CACTTCTCCTTGTCTCTGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 337}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673386_1142673398 16 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188
1142673386_1142673393 3 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673386_1142673396 5 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673396 17:1498031-1498053 CCGGCGGTATGGGAGTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1142673386_1142673394 4 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673386_1142673391 -6 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673386_1142673397 15 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673397 17:1498041-1498063 GGGAGTGTCGGGGCCAGCACAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1142673386_1142673392 -5 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673386 Original CRISPR CACTTCTCCTTGTCTCTGAG GGG (reversed) Exonic
900232831 1:1570381-1570403 CACTTCTCCTGGCCTCTGGTCGG - Intronic
900326093 1:2109356-2109378 CACCTTCCCTTGTCTCTGGGGGG + Intronic
901469246 1:9444191-9444213 TAATACTCCTTGTGTCTGAGGGG + Intergenic
903202167 1:21750313-21750335 CTCTTCTCCTTGTTTCTAACGGG + Intronic
903574760 1:24332339-24332361 GTCTTGGCCTTGTCTCTGAGAGG + Intronic
904614241 1:31741531-31741553 CACTCCTCCGTATCTCAGAGAGG + Intronic
904719720 1:32499037-32499059 CACTTCTCTTTGTGCCTGTGTGG + Intronic
905908114 1:41633212-41633234 CATTTCTCCTTTTATTTGAGGGG - Intronic
907963854 1:59310053-59310075 GACTTGGCATTGTCTCTGAGGGG + Intronic
908328822 1:63050505-63050527 GACTTCTCCTAGACTCTGAATGG - Intergenic
908592186 1:65646710-65646732 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
911307513 1:96248999-96249021 CACTTCTCCATATTTATGAGAGG - Intergenic
911570189 1:99510569-99510591 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
911881069 1:103238736-103238758 CACATCTCATTGGCTCTGATTGG - Intergenic
912379972 1:109242088-109242110 CAGTTCACCTTCCCTCTGAGGGG - Intergenic
913134863 1:115878417-115878439 CTCTTCCCCTTGACTCTGAGAGG + Intergenic
914335958 1:146715147-146715169 CCAGCCTCCTTGTCTCTGAGTGG - Intergenic
914421610 1:147533269-147533291 CTTATCTCTTTGTCTCTGAGTGG + Intergenic
915506347 1:156358892-156358914 CCCATCTCTTTGTCTCTGACTGG + Intronic
918083084 1:181222245-181222267 TGCTTCTCCTTGTCTCAGAGAGG + Intergenic
918564281 1:185909315-185909337 CACTTCTCTTTCTCTCTTATAGG + Exonic
920829197 1:209449933-209449955 CCCTTCTCCTTCACCCTGAGCGG + Intergenic
923076108 1:230610197-230610219 CATGTCTACCTGTCTCTGAGGGG - Intergenic
923962557 1:239102174-239102196 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1063047923 10:2412489-2412511 GCCTTCTCCTTGACTCTGCGTGG + Intergenic
1063509820 10:6634388-6634410 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1063527875 10:6801801-6801823 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1066206668 10:33196192-33196214 CTCTTCTCCTTGACTATGAAAGG - Intronic
1067007014 10:42673793-42673815 CACTTGGCCTTGTTTCTGATTGG - Intergenic
1068006161 10:51394002-51394024 CACTTCTCTTGACCTCTGAGGGG + Intronic
1068058557 10:52038543-52038565 CCCTTCTCCTTCACTCTTAGCGG - Intronic
1070054736 10:72923961-72923983 ATCTGCTCCTTATCTCTGAGGGG - Intronic
1070698579 10:78582043-78582065 CCTTTCTCCTTGTCACTGAGTGG + Intergenic
1071897934 10:90085776-90085798 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1072941658 10:99769756-99769778 AACTTCTCCTGGTATCTCAGTGG - Intergenic
1074869257 10:117564112-117564134 CACCTCTGCCTGTCTCTGTGTGG + Intergenic
1074968854 10:118519044-118519066 ATGTTCTCTTTGTCTCTGAGCGG + Intergenic
1079806355 11:24935093-24935115 CATGTCTCCTTGCTTCTGAGAGG + Intronic
1080028125 11:27633850-27633872 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1080297819 11:30750716-30750738 CATTTCTCCTCGTATCTGAAGGG - Intergenic
1080568748 11:33536622-33536644 CCCCTCTCCTTGAATCTGAGTGG - Intergenic
1080654892 11:34251153-34251175 CCATTCTCCTTGCCTCTGAGAGG - Intronic
1080983995 11:37439741-37439763 CACTTCTCCTGGTCTCAGTTTGG + Intergenic
1083158983 11:60842868-60842890 CACTTCACCTTTTCTTGGAGCGG - Exonic
1083435611 11:62640916-62640938 TACTGCTCCTTTCCTCTGAGAGG - Intronic
1084355345 11:68634687-68634709 CCCTTCTCCTTCACCCTGAGTGG + Intergenic
1084533341 11:69742445-69742467 CTCTTCTCCAGGTCTCTGCGGGG - Intergenic
1085100443 11:73796089-73796111 CACTTGTCCCTGGCTCTGACTGG - Intronic
1086890552 11:92253251-92253273 CCCTTTTCCCTGTTTCTGAGTGG + Intergenic
1087221144 11:95547573-95547595 TACTTCTCCTTGTCTTTCACAGG + Intergenic
1087314444 11:96588760-96588782 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1087378091 11:97369024-97369046 CCCTTCTCCTTATCTCTTACAGG - Intergenic
1087629812 11:100636892-100636914 CATTTCTCCTGGTGGCTGAGAGG - Intergenic
1088036688 11:105325729-105325751 CACTCCTCCGTGTCACAGAGTGG - Intergenic
1089987181 11:122825385-122825407 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1091678003 12:2505219-2505241 CACTTCTCCTTGTGCCTTCGTGG + Intronic
1091784182 12:3232359-3232381 GACTCCTCCTTATCTCTTAGTGG - Intronic
1092210693 12:6644518-6644540 CAATCCTCCTTGTCCCTGGGAGG - Exonic
1092474258 12:8805824-8805846 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1095178775 12:39123162-39123184 CACTGCTCTTTCCCTCTGAGTGG + Intergenic
1097417268 12:59327986-59328008 CACTTCCCCTTCACTCTTAGCGG - Intergenic
1097582799 12:61479861-61479883 CACTTCTCCTTGAATCTGGGTGG + Intergenic
1099167284 12:79322011-79322033 CACTTCATCTTGGCCCTGAGAGG - Intronic
1099292314 12:80787922-80787944 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1099795049 12:87389320-87389342 CACTTTTTCTGGTCCCTGAGCGG - Intergenic
1100407732 12:94285767-94285789 CACCTCTCCCTGTGTCTGGGTGG + Intronic
1100561129 12:95750021-95750043 CCCTTCTCCTTCACTCTTAGCGG + Intronic
1101284857 12:103301312-103301334 GACTTCTCTTTGTTTCTGAAGGG + Intronic
1102149668 12:110680020-110680042 CAGCTCTCCTCGTTTCTGAGAGG - Intronic
1103037418 12:117667644-117667666 CTCTTCTTCTTGGCTCTGAAAGG + Exonic
1103213014 12:119180121-119180143 CACCTCTCCTTGTCCCAGACAGG + Intronic
1103427264 12:120847022-120847044 CACTTCTCCCTGAGCCTGAGGGG - Intronic
1103892188 12:124248182-124248204 CACGTCTCCTTGTTTCTCAAGGG - Intronic
1105505658 13:21007483-21007505 CCCTTATCCTTGGCTCTGATTGG - Intronic
1106124521 13:26889441-26889463 CACTTCTGTTTGTTTCTGACAGG - Intergenic
1106873089 13:34042973-34042995 CCCTTCCCCTTGAATCTGAGTGG - Intergenic
1107765040 13:43725495-43725517 CTCTTGTCCTTGTCTCGGAGAGG - Intronic
1108913624 13:55583005-55583027 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1111946059 13:94667260-94667282 GACTCCCCCATGTCTCTGAGTGG + Intergenic
1112181313 13:97083743-97083765 CACATGTCCTCCTCTCTGAGTGG + Intergenic
1112821236 13:103338576-103338598 CCTTTCTCCTCTTCTCTGAGGGG - Intergenic
1112963796 13:105161938-105161960 CACTTCTGGTTTTCTCTGGGAGG - Intergenic
1113744937 13:112737642-112737664 GCCTTCTCCTTTTATCTGAGTGG + Intronic
1114015099 14:18421187-18421209 CACTGCTCCTGGGTTCTGAGTGG - Intergenic
1114016969 14:18439263-18439285 CACTGCTGCTGGTTTCTGAGTGG - Intergenic
1114024402 14:18511734-18511756 CACTTCTGCTGGTTTCTGAGTGG + Intergenic
1114257339 14:21014664-21014686 CACCTCTCCTCTCCTCTGAGAGG + Intergenic
1114349920 14:21838358-21838380 CACTTCTTCTCCACTCTGAGAGG - Intergenic
1114379195 14:22183122-22183144 CACTTCTACTTGAGCCTGAGAGG + Intergenic
1114811170 14:25901341-25901363 CACATCTCCCTGTCTCTGTCTGG + Intergenic
1115892967 14:38052957-38052979 CACTGCTCCTCCTTTCTGAGTGG + Intergenic
1116703529 14:48267298-48267320 CCCTTCTCCTTCACCCTGAGCGG - Intergenic
1117810732 14:59543888-59543910 TAGTGCTCCATGTCTCTGAGTGG + Intronic
1119022188 14:71125169-71125191 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1119804661 14:77475073-77475095 CACCCCTCCTTATCTCTGGGTGG - Exonic
1121710017 14:96030735-96030757 CGCTGCTCCTGGTCTCAGAGCGG + Intergenic
1121935504 14:98014811-98014833 CACTGCTACTAGGCTCTGAGTGG + Intergenic
1121947016 14:98132969-98132991 CATATTTCCTTGTCTCTGATTGG + Intergenic
1122045558 14:99020759-99020781 CATTTCTCCCTGTGTCTGATTGG - Intergenic
1122545265 14:102518177-102518199 GAGATCTCCTTGTCTCTCAGGGG - Intergenic
1202837984 14_GL000009v2_random:92674-92696 CACTTCTGCTGGTGTCTGAATGG + Intergenic
1202907348 14_GL000194v1_random:82642-82664 CACTTCTGCTGGTGTCTGAATGG + Intergenic
1202885716 14_KI270722v1_random:105208-105230 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1124611647 15:31213792-31213814 CAGTTCTCCCTTTCTCTGAGGGG + Intergenic
1124639735 15:31390175-31390197 CCCCACTCCTTGTCCCTGAGTGG + Intronic
1124835225 15:33190455-33190477 CAGTTCTCTTTCTCTTTGAGAGG + Intronic
1125430340 15:39587534-39587556 CAGTTCTCCACGTCCCTGAGAGG - Intronic
1126061387 15:44785875-44785897 CATTTCATTTTGTCTCTGAGGGG - Intergenic
1127526082 15:59792700-59792722 CACTTGTCCCTGGCTCTGGGTGG + Intergenic
1128611356 15:69076116-69076138 CACTACACCTGGCCTCTGAGGGG - Intergenic
1129421815 15:75434099-75434121 CACTTCTTCTCTTCTGTGAGAGG - Intronic
1129849886 15:78787760-78787782 CCCTTCTTCCTGTCTCTGACCGG + Intronic
1130837946 15:87670173-87670195 CACATTTCCCTGTCTCGGAGCGG - Intergenic
1130955512 15:88624429-88624451 CACTGCTCCTTCTCCCAGAGAGG - Intronic
1132340206 15:101073492-101073514 CCCTTCTCCTTCACCCTGAGCGG + Intronic
1133102462 16:3487656-3487678 CAGTTCTCCTCATCTCTAAGAGG - Intergenic
1133651183 16:7815638-7815660 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1133860683 16:9592136-9592158 CTCTTCTCCCTGGCTTTGAGGGG + Intergenic
1134047491 16:11111494-11111516 CCCTTCTCCTTGAACCTGAGTGG - Intronic
1138106656 16:54290610-54290632 CACTTCCCTGCGTCTCTGAGCGG + Intergenic
1138166048 16:54802627-54802649 CCGTTCTCCTTGTCTCTTAGGGG - Intergenic
1139384627 16:66557885-66557907 GACTTCTCTTTGTCTTTTAGAGG - Intronic
1139997666 16:70996076-70996098 CCAGCCTCCTTGTCTCTGAGTGG + Intronic
1140307300 16:73815396-73815418 CACTTCTCATGGTCTCCTAGGGG - Intergenic
1141064093 16:80900080-80900102 CACTTTTGCTTGTCTGTGAGTGG - Intergenic
1141741674 16:85897634-85897656 CACTTACCCTTGTCTTTAAGTGG + Intergenic
1142205981 16:88783472-88783494 CATTTCCTCTTGTGTCTGAGTGG - Intronic
1142673386 17:1498003-1498025 CACTTCTCCTTGTCTCTGAGGGG - Exonic
1144693828 17:17287640-17287662 CACTTCTACTTGTGTTTCAGTGG - Intergenic
1147001434 17:37365479-37365501 GTCTTCACGTTGTCTCTGAGAGG + Intronic
1147445961 17:40475470-40475492 CGCCTCTCCTTGTCTCTCAGTGG + Intergenic
1147869774 17:43579050-43579072 CACCTCTCTCTGCCTCTGAGGGG + Intronic
1148035378 17:44656252-44656274 TTCCTCTCCTTGTCTCTGGGGGG + Intergenic
1148108379 17:45131433-45131455 CACTTTTCCCAGACTCTGAGAGG + Intronic
1148557438 17:48586959-48586981 CACTCTTCCTTGTCTCTGGTGGG - Intronic
1149127898 17:53257581-53257603 TACTCCTACTAGTCTCTGAGGGG - Intergenic
1149275508 17:55030418-55030440 CACTTCCCCTTGTATCTCATTGG + Intronic
1150349272 17:64430160-64430182 CACTGCACCTGGTCTCTGACTGG + Intergenic
1151381271 17:73727355-73727377 AAGTTCTCCCTGTCTCTGAAGGG - Intergenic
1151444765 17:74156050-74156072 CCCTTCTCCGTGTCTCAGAGGGG + Intergenic
1152217789 17:79044487-79044509 CACTTCTCCCTGCCTCCAAGTGG - Intronic
1152492697 17:80648417-80648439 ATCTTCTCCTTGTCCCTGAATGG + Intronic
1152890180 17:82876198-82876220 CACTTCCCCTTGACTCGGACAGG + Intronic
1155293091 18:24360693-24360715 CACATGTCCTTGTGTCTGCGTGG + Intronic
1155786211 18:29903878-29903900 CATTTCTCCTAGTCTCTGTTTGG + Intergenic
1155828567 18:30481682-30481704 CCCCTTTCCTTGTATCTGAGTGG + Intergenic
1156894743 18:42232916-42232938 CCATTCTCCTTTTCTCTGAATGG + Intergenic
1158336192 18:56416631-56416653 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1158394871 18:57071473-57071495 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1158626047 18:59072447-59072469 CACTTCTCCTTGTGTGTCATTGG - Intergenic
1164685980 19:30167219-30167241 CCCTTCTCCTTGTCAGTGGGGGG - Intergenic
1167208810 19:48120420-48120442 CACTACTGCGTGTCTCTGGGTGG + Intronic
1167257936 19:48442443-48442465 CACATCTCCTTGTCTCTGCTCGG - Intronic
1168228178 19:55011453-55011475 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1168654850 19:58119643-58119665 GACTTTTCCTTGTTTATGAGGGG + Intergenic
1202634678 1_KI270706v1_random:34804-34826 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1202661117 1_KI270708v1_random:72185-72207 CACTTCTGCTGGTGTCTGAATGG - Intergenic
925685654 2:6470416-6470438 TAATTCTGCTTCTCTCTGAGTGG + Intergenic
925966422 2:9071220-9071242 CATTTCACTTTGTCTCAGAGAGG + Intergenic
926413391 2:12627453-12627475 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
929076899 2:38085552-38085574 CCCTTCTCCTTCACCCTGAGCGG - Intronic
931042487 2:58315111-58315133 CCCTTCTCCTTCACCCTGAGTGG + Intergenic
932153761 2:69396715-69396737 CACTTCTCCTTGTCTCAAAGAGG + Intronic
932286923 2:70542385-70542407 CAATTCTCCTAGGCGCTGAGAGG - Intronic
932295614 2:70621451-70621473 CCCTTCTCCTTCACTCTTAGTGG + Intronic
932893615 2:75617433-75617455 ACCTTCTCCTGCTCTCTGAGTGG + Intergenic
933222675 2:79708834-79708856 CTGTTCTCCTTTTCTATGAGAGG + Intronic
933609232 2:84416463-84416485 CACTTTTGCTTGTTTCTGACTGG - Intergenic
934094999 2:88593269-88593291 CACTTCTCATTGCCACTGCGAGG + Exonic
935006954 2:99088535-99088557 CAGTTCTCATTCTCTCTGAAAGG + Intronic
937558842 2:123194897-123194919 CACTTCCCACTGGCTCTGAGAGG + Intergenic
938731395 2:134150604-134150626 CTCTTCTCTTAATCTCTGAGAGG - Intronic
939208144 2:139134420-139134442 CACTTCTCGGTGTTTCTGTGAGG + Intergenic
939645412 2:144691814-144691836 TATTTCCCCTTTTCTCTGAGTGG + Intergenic
939818300 2:146923193-146923215 TACTTCTCCTTGTCCTTGAAAGG - Intergenic
940254337 2:151713262-151713284 CCCTTCTCTTTTTCTGTGAGGGG + Intronic
940529982 2:154868279-154868301 CCCTTCTCCTTCACCCTGAGTGG + Intergenic
940676023 2:156724865-156724887 CCCTTCTCCTTCACCCTGAGTGG - Intergenic
941013886 2:160332709-160332731 CACTCCTTTTTGGCTCTGAGGGG - Intronic
942096901 2:172542813-172542835 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
944876339 2:203966706-203966728 CACTTCTCCTTCACCCTTAGCGG - Intergenic
945028662 2:205643284-205643306 CCCTTCTCCTAGTCCCAGAGGGG + Intergenic
948771639 2:240254260-240254282 CTTTTCTCATTGTCTCTGGGTGG + Intergenic
1169931081 20:10833759-10833781 CTCTTCTCCTCATCTGTGAGGGG - Intergenic
1170594526 20:17794961-17794983 AATTCCTCTTTGTCTCTGAGGGG - Intergenic
1172573596 20:35989400-35989422 CACTTTTCTTTGTCTATGTGTGG - Intronic
1173618519 20:44418688-44418710 CACATTTCCTTGCATCTGAGTGG - Intronic
1174500842 20:50982810-50982832 CACTTCTCTTTTTCTCAGAGAGG + Intergenic
1176601266 21:8797216-8797238 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1176646891 21:9360525-9360547 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1177454405 21:21317198-21317220 CCCTTCTCCCACTCTCTGAGTGG + Intronic
1179724624 21:43335261-43335283 CACTGCTCCCTGCCTCTGAGAGG - Intergenic
1180050586 21:45329347-45329369 CACTTGTGCTTGTCTCTGCCTGG + Intergenic
1180328587 22:11455542-11455564 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1180343551 22:11688753-11688775 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1180366029 22:11938424-11938446 CACTTCTGCTGGTGTCTGAATGG + Intergenic
1180417211 22:12778330-12778352 CACTTCTGCTGGTGTCTGAATGG + Intergenic
1180439600 22:15351964-15351986 CACTTCTCCTGGGTTCTGAGTGG - Intergenic
1180441475 22:15370136-15370158 CACTGCTGCTGGTTTCTGAGTGG - Intergenic
1180441506 22:15370423-15370445 CACTTCTGCTGGGTTCTGAGTGG - Intergenic
1180448569 22:15439261-15439283 CACTTCTGCTGGTTTCTGAGTGG + Intergenic
1180522485 22:16222541-16222563 CACTGCTCCTGGGTTCTGAGTGG - Intergenic
1182421747 22:30251815-30251837 GGCTTCTCCTTGGCCCTGAGGGG - Intergenic
1182878465 22:33712533-33712555 AACCCCTCCTTGACTCTGAGTGG + Intronic
1183390717 22:37544367-37544389 CCCTTCTCCAAGTCTCTGACTGG - Intergenic
1183463475 22:37967193-37967215 CACTTCTCCAAATCTCTGGGAGG + Intronic
949162307 3:895430-895452 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
949294422 3:2504434-2504456 CACTTCTCATTTTGTGTGAGAGG + Intronic
949341668 3:3037297-3037319 CTGTTCTCCGTTTCTCTGAGGGG - Exonic
949921901 3:9009675-9009697 CTCTTCTCCTTGTCTGGAAGGGG + Intronic
951383167 3:22010606-22010628 CTCTTCTGATTGTCTCTGAATGG + Intronic
951926471 3:27913853-27913875 CCCTTCCCCTTGAATCTGAGCGG + Intergenic
952526848 3:34219689-34219711 CATTTCATTTTGTCTCTGAGGGG + Intergenic
953152111 3:40334060-40334082 CACATCTGCATGTCTCTGACAGG + Intergenic
953574650 3:44103327-44103349 CAGTTCTCCTTGTCCTTGAGAGG - Intergenic
953825916 3:46251028-46251050 CCCTTCTCCTTCACTCTTAGTGG - Intronic
954375327 3:50191515-50191537 CACCTGTCCTTGTCTCTGATTGG + Intergenic
954716105 3:52527704-52527726 CGCATCCCCTTGTCTCTGTGTGG + Exonic
956072766 3:65471931-65471953 CACCTCTCCTTTCCTCTGTGTGG - Intronic
956835543 3:73093427-73093449 CAGTTTTCCTTGTTACTGAGGGG + Intergenic
958898680 3:99860308-99860330 CACTTCTCCTGACCTCTGGGGGG - Intronic
960725226 3:120663245-120663267 TACTTCCCCTTCTCTCAGAGGGG + Intronic
961105319 3:124235735-124235757 CACTGCTCTCTGTCTCTTAGTGG + Intronic
961268390 3:125667706-125667728 CACTGTTTCTTATCTCTGAGTGG - Intergenic
961752790 3:129107146-129107168 CATTACTCCTTATGTCTGAGGGG + Intronic
963019571 3:140859770-140859792 AAGTTCTCATTGTCTCAGAGCGG - Intergenic
963693283 3:148532654-148532676 CCCTTCTCCTTGAATCTGGGTGG - Intergenic
965626558 3:170688230-170688252 CCCTTCTCCTTCACTCTTAGTGG - Intronic
966286219 3:178298635-178298657 CAATTCTCATTGTCAGTGAGTGG - Intergenic
966869535 3:184281217-184281239 CACTTCTACTACCCTCTGAGTGG + Intronic
967210781 3:187166610-187166632 CACTTCTTTTTGTCTATGTGAGG - Intronic
967618534 3:191603652-191603674 AACTTCTCCTTCTCTGTGAGAGG + Intergenic
967624869 3:191671284-191671306 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1202739991 3_GL000221v1_random:44467-44489 CACTTCTGCTGGTGTCTGAATGG + Intergenic
971316749 4:25574041-25574063 CTCATCTCCTTGTGTCTGATGGG + Intergenic
973364593 4:49199008-49199030 CACTTCTGCTGGTGTCTGAATGG - Intergenic
973395999 4:49593442-49593464 CACTTCTGCTGGTGTCTGAATGG + Intergenic
973396319 4:49596255-49596277 CACTTCTGCTGGTGTCTGAATGG + Intergenic
976884778 4:89969503-89969525 CTCTTCTCCTTCACCCTGAGTGG - Intergenic
977075401 4:92443636-92443658 CCCTTCTCCTTCACTCTTAGCGG - Intronic
977431307 4:96933611-96933633 ACCTTCCCCTTGTCTTTGAGTGG + Intergenic
978716320 4:111847263-111847285 CACTTATCCTTGTGTCTGGCAGG + Intergenic
979379682 4:119994729-119994751 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
980311489 4:131136370-131136392 TATTTCTTCTTGACTCTGAGTGG - Intergenic
980388704 4:132119132-132119154 CCCTTCTCCTTCACCCTGAGCGG + Intergenic
980894356 4:138847564-138847586 CATGTCTCCTTGGCTCTGACTGG - Intergenic
981205838 4:142039037-142039059 CACATCTCCCTGCTTCTGAGAGG - Intronic
982497342 4:156108331-156108353 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
983023671 4:162710138-162710160 CCCTTCTCCTTAACCCTGAGCGG + Intergenic
984436097 4:179712198-179712220 CCCCTCTGGTTGTCTCTGAGTGG - Intergenic
984672831 4:182511527-182511549 AACTTCACCTTGCCTCTGAGAGG + Intronic
984799245 4:183697853-183697875 CAATTCTCCTGGTCTTTAAGTGG - Intronic
984916632 4:184731146-184731168 AACTTTTCCATGTCCCTGAGGGG - Intronic
985177406 4:187216016-187216038 CACTTCTCTCTGACTCTCAGAGG - Intergenic
1202762016 4_GL000008v2_random:120906-120928 CACTTCTGCTGGTGTCTGAATGG - Intergenic
986919805 5:12667319-12667341 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
987230517 5:15889120-15889142 TACCATTCCTTGTCTCTGAGAGG - Intronic
987970529 5:24938536-24938558 CACTTCTCCTTGCCCGTGACAGG - Intergenic
989997482 5:50853182-50853204 CATTTTTCCTTTTTTCTGAGAGG - Intergenic
990490857 5:56301396-56301418 GACTTCTCCTTGCATCTGATTGG - Intergenic
990579118 5:57151194-57151216 CACTTCTGCTGGTATCTCAGTGG + Intergenic
992265382 5:75013123-75013145 CCCTTCTCCTTGAATCTGGGTGG - Intergenic
995373604 5:111449362-111449384 CACTTCTTGTTTTCTATGAGAGG + Intronic
995846886 5:116503040-116503062 CACTTCTCTTTGGCTGAGAGTGG + Intronic
995899614 5:117051260-117051282 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
996203481 5:120702392-120702414 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
996368746 5:122730755-122730777 CATGTCTCCCTGTCTCTGATTGG + Intergenic
996556989 5:124788327-124788349 CACATCTCATTGGCTCTGATTGG + Intergenic
998214312 5:140225827-140225849 CTCTTCCTCTTCTCTCTGAGTGG + Intronic
999910525 5:156193467-156193489 CATTTCTCCTGGCCTCTGTGTGG + Intronic
1000147391 5:158466736-158466758 CATGACTCCTTGGCTCTGAGTGG + Intergenic
1000519632 5:162280174-162280196 CACTTCTCCTTCACCCTTAGTGG - Intergenic
1000629327 5:163573775-163573797 CCCTTCCCCTTGCATCTGAGTGG - Intergenic
1000695596 5:164377655-164377677 CAATTCTCATGGTTTCTGAGAGG + Intergenic
1001331696 5:170766893-170766915 CCCTTCTCCTTCACTCTTAGTGG - Intronic
1001664490 5:173421276-173421298 CACTTTTCCTGGTCTCTTTGGGG + Intergenic
1003094709 6:3133238-3133260 CTCTTCTGCTGGGCTCTGAGTGG + Intronic
1004575018 6:16886932-16886954 CCCTTCTCCTTCACCCTGAGCGG + Intergenic
1004768809 6:18758914-18758936 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1005610591 6:27520017-27520039 CACTAATCCTTGTTTCTCAGTGG - Intergenic
1005689990 6:28295095-28295117 CACTCATCATTGTCTTTGAGAGG + Intronic
1005701277 6:28403006-28403028 CACTTTCCCTTGAATCTGAGTGG + Intergenic
1005843157 6:29757846-29757868 CACTTCTCCCTGTTTCTGCTGGG + Intergenic
1007132672 6:39491075-39491097 TCCTTCTCCTTGAATCTGAGTGG + Intronic
1007419994 6:41713521-41713543 CTCCTCTAATTGTCTCTGAGAGG + Intronic
1007846970 6:44767250-44767272 CACATTTCCTTCTCTCAGAGGGG - Intergenic
1007906859 6:45470668-45470690 TACTTCTCCTGGTCTCTATGAGG + Intronic
1009338598 6:62525723-62525745 CTCTTCTCCTTCTGTCTGCGGGG + Intergenic
1012315595 6:97780505-97780527 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1012963902 6:105652205-105652227 TCCTTTTCCCTGTCTCTGAGAGG - Intergenic
1013352187 6:109315966-109315988 GACTTCTCCTTGTTGCTCAGTGG - Intergenic
1013408110 6:109860592-109860614 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1014555634 6:122840813-122840835 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1014794208 6:125706621-125706643 CCCTTCTCCTTCACTCTTAGTGG - Intergenic
1015928565 6:138334457-138334479 CTCTTCTCCTTGCCTCTCGGGGG - Exonic
1016774438 6:147889730-147889752 CACTACTCCTGGGCTCTGTGTGG + Intergenic
1017779564 6:157705511-157705533 CCCTTCTCCTTCACTCTTAGTGG - Intronic
1018443015 6:163830628-163830650 GTTTTCACCTTGTCTCTGAGTGG - Intergenic
1018683682 6:166284956-166284978 CAAGTAGCCTTGTCTCTGAGGGG - Intergenic
1018898600 6:168038872-168038894 CAGTGCTCCTTGTCACTGAGTGG + Intronic
1018949577 6:168370533-168370555 CCCTTCTCCTTGTCTGTGCCCGG + Intergenic
1019136708 6:169913221-169913243 CACTTGGCTTAGTCTCTGAGGGG - Intergenic
1019936648 7:4262521-4262543 CACTTTTCCGTGTGTTTGAGGGG + Intronic
1020078219 7:5272801-5272823 CACGTCACCTTGTCCATGAGTGG - Intergenic
1020349504 7:7202316-7202338 CACTACTCGGTGTGTCTGAGTGG + Intronic
1020522326 7:9206993-9207015 CACTTCACCCTGTCTCCCAGTGG - Intergenic
1020532946 7:9358249-9358271 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1021483679 7:21145166-21145188 ACCTTCTCCTTGACTCTGTGTGG + Intergenic
1021637105 7:22704276-22704298 CCCTTCTCCTTCACCCTGAGTGG + Intergenic
1024185799 7:46946669-46946691 CACTGCTCCCTGTGACTGAGAGG - Intergenic
1024225913 7:47326890-47326912 CACTTGGGCTTGTCTCAGAGCGG + Intronic
1027862029 7:83596411-83596433 CACTGCTCCTAGGCTCTCAGTGG + Intronic
1028178591 7:87687303-87687325 CACTTCTTCTAGTATCTGAATGG + Intronic
1029293824 7:99523300-99523322 CTCCTCCCCTTGTCTCTCAGTGG - Intronic
1029627144 7:101727058-101727080 CACTTCTCCTGGACTCTCTGAGG - Intergenic
1030004265 7:105100079-105100101 CACTTCTCCTAGTCTGGGACGGG - Intronic
1031525340 7:122817726-122817748 CCCTTCTCCTTCACTCTTAGCGG + Intronic
1031776107 7:125910895-125910917 CCCTTCTCCTTCACTCTTAGTGG + Intergenic
1033909697 7:146248247-146248269 CCCTTCTCCTTCACCCTGAGCGG - Intronic
1034393627 7:150803768-150803790 GACTTCTTCTGGACTCTGAGTGG - Exonic
1035129810 7:156641014-156641036 CACAGCTCCTTCTATCTGAGGGG + Intronic
1037926322 8:22846557-22846579 CAGTTCTCCTTCTCTTGGAGAGG + Intronic
1039313539 8:36346168-36346190 AATTTCTCTTTTTCTCTGAGGGG + Intergenic
1039351607 8:36769830-36769852 CACTTCTTCCTGTCTCCTAGGGG + Intergenic
1039977710 8:42381427-42381449 CACTCCTCTCTGTCTCTCAGAGG - Intergenic
1041498779 8:58516743-58516765 CACTTCTTCCTGTCTCAGAGTGG - Intergenic
1041518857 8:58732614-58732636 CCCTTCTCCTGGTCACTGATTGG + Intergenic
1042321699 8:67482339-67482361 CACTTTCCCTTCTCTCTGATGGG - Intronic
1044533934 8:93338619-93338641 CACTGCTACCTGTGTCTGAGAGG + Intergenic
1047878162 8:129163503-129163525 CCCTTGTCCTTGAATCTGAGTGG - Intergenic
1048097392 8:131311118-131311140 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1048835604 8:138516050-138516072 CTCTGGTCCCTGTCTCTGAGGGG + Intergenic
1050256451 9:3797044-3797066 CACTTGTCTTCCTCTCTGAGGGG + Intergenic
1050972367 9:11893651-11893673 CACTTCTCTGTCTGTCTGAGTGG + Intergenic
1051054889 9:12973152-12973174 CAGTCCTCCTTGTTTCTTAGGGG + Intergenic
1052475407 9:28952761-28952783 CACTTCTACTTATCTCTGCTGGG - Intergenic
1053717808 9:40914578-40914600 CACTTCTTCTTGGGTCTGAACGG + Intergenic
1055347920 9:75356482-75356504 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1055809824 9:80138287-80138309 CTCTTCTCCTTCACTCTTAGCGG + Intergenic
1056505359 9:87253171-87253193 CACTTCTCCTTGAATCTAGGTGG + Intergenic
1056925345 9:90829509-90829531 CACGTCTTCTTGCCTCTAAGTGG - Intronic
1057234620 9:93348535-93348557 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1057509751 9:95668157-95668179 CAATTCCCCTTGCCTCTGAGAGG - Intergenic
1058891551 9:109365503-109365525 CACTCCTCCTTGTGTCAGACAGG - Intergenic
1059259586 9:112962946-112962968 TACTTCTCCTTTTCTCTTATGGG - Intergenic
1060243491 9:121925309-121925331 CTCATCTCCTGGGCTCTGAGGGG - Intronic
1060670129 9:125461457-125461479 CACCTCTCCTTGGGCCTGAGTGG - Intronic
1203708633 Un_KI270742v1:74424-74446 CACTTCTGCTGGTGTCTGAATGG + Intergenic
1203542782 Un_KI270743v1:105787-105809 CACTTCTGCTGGTGTCTGAATGG - Intergenic
1185547520 X:957377-957399 CACTTCCCATTGTGTCTTAGAGG + Intergenic
1187086740 X:16049450-16049472 CCCTTCTCCTTCACCCTGAGTGG - Intergenic
1187100106 X:16183451-16183473 CCCTTCTCCTTCACTCTTAGCGG - Intergenic
1187261131 X:17686330-17686352 CACTTGACCTGGTTTCTGAGGGG + Intronic
1189292960 X:39898951-39898973 CCCCTCTCCTTGAATCTGAGTGG + Intergenic
1189951421 X:46235223-46235245 CACTTCACCTGGTTTCTGTGAGG + Intergenic
1194655152 X:96564245-96564267 TATTTTTCCTTGTCTCAGAGCGG - Intergenic
1195541616 X:106068786-106068808 CAGTTGTCTTTGTCTCTGCGTGG + Intergenic
1196165292 X:112531400-112531422 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1196330586 X:114467607-114467629 CCCTTCTCCTTCACTCTTAGCGG + Intergenic
1197782256 X:130170942-130170964 CCCTTCTCCTAGCCTCTGTGTGG + Intergenic
1199072047 X:143488642-143488664 CCCTTTTCCTTGTATTTGAGTGG + Intergenic
1201163227 Y:11182797-11182819 CACTTCTACTGGTGTCTGAATGG + Intergenic
1201360255 Y:13139003-13139025 CACTTCTGTTTGTCTCTGTTAGG - Intergenic