ID: 1142673387

View in Genome Browser
Species Human (GRCh38)
Location 17:1498004-1498026
Sequence ACACTTCTCCTTGTCTCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673387_1142673393 2 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673387_1142673394 3 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673387_1142673398 15 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188
1142673387_1142673391 -7 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673387_1142673397 14 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673397 17:1498041-1498063 GGGAGTGTCGGGGCCAGCACAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1142673387_1142673396 4 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673396 17:1498031-1498053 CCGGCGGTATGGGAGTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1142673387_1142673392 -6 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673387 Original CRISPR ACACTTCTCCTTGTCTCTGA GGG (reversed) Exonic
900780660 1:4615377-4615399 ACCATTTTCCTTGTCTCTCAGGG + Intergenic
901469245 1:9444190-9444212 ATAATACTCCTTGTGTCTGAGGG + Intergenic
903202166 1:21750312-21750334 ACTCTTCTCCTTGTTTCTAACGG + Intronic
905137309 1:35808928-35808950 ACACCTCTCATGATCTCTGAAGG + Intronic
905908115 1:41633213-41633235 ACATTTCTCCTTTTATTTGAGGG - Intronic
907585465 1:55613076-55613098 ACACTTCCCCTTGTATTTGCTGG + Intergenic
908962785 1:69720558-69720580 AATATTCTCCTTGTGTCTGAAGG + Intronic
910490649 1:87765682-87765704 GCACTTGTCCTTGTCTCAGAGGG + Intergenic
911671850 1:100616487-100616509 ACACTTCTCCTACTCCCTGAAGG + Intergenic
911803280 1:102173073-102173095 AAACTTTTGCTTGTCTCAGATGG + Intergenic
912379973 1:109242089-109242111 ACAGTTCACCTTCCCTCTGAGGG - Intergenic
914591836 1:149113363-149113385 AGATTTCTGCTTGACTCTGAGGG + Intergenic
918217054 1:182400911-182400933 ACACTTGTCCCTCTCTCTCATGG + Intergenic
918293998 1:183138191-183138213 AAACTTGTCTTTGTCTCTAAAGG - Intronic
919160234 1:193820316-193820338 GAACATCACCTTGTCTCTGAAGG - Intergenic
920149728 1:203895322-203895344 ACCTTTTTCCTTGTCCCTGAAGG - Intergenic
920653988 1:207861238-207861260 ACATATCTCCTTGTCACTGAAGG - Intergenic
921225848 1:213018214-213018236 ACATTTCTCCTTACCTCTTAGGG - Intergenic
921476390 1:215615799-215615821 ACACTTTTCCTTGTGTCTTTGGG - Intronic
923919705 1:238549589-238549611 ATATTTCTCCTTGCTTCTGATGG - Intergenic
1063887019 10:10589897-10589919 ACACTGCTCCTGGTATCTGAGGG - Intergenic
1065077558 10:22096882-22096904 AAGCTTCTTCTTGTCTCAGAAGG + Intergenic
1065433396 10:25682421-25682443 ACTCTTGTCCGTGTCGCTGAAGG - Intergenic
1065742499 10:28809870-28809892 TCATTTCTCCTTGTCTCAGATGG + Intergenic
1066020152 10:31290485-31290507 ACACTTCTCATTGTGTGAGAAGG - Intergenic
1069138052 10:64789427-64789449 ACAATTTTCCATGTCACTGAAGG + Intergenic
1072164452 10:92799409-92799431 ACCCTGCTCCTTGTTTCTCATGG + Intergenic
1073377550 10:103049685-103049707 AAACTTTTTCTTGTCTCTAAAGG + Exonic
1073700545 10:105921872-105921894 TTACTTCACCTTGTGTCTGAAGG + Intergenic
1074257978 10:111822533-111822555 ACACTTCGCCTTGTAACTCATGG - Intergenic
1074867211 10:117551952-117551974 ACAGTTCTCCGTGTCCCAGAAGG - Intergenic
1077706191 11:4488721-4488743 ATACTTCTCCATGTCTATGAAGG + Intergenic
1077726627 11:4681715-4681737 ACACTTCTCCTTATCTTTATTGG - Exonic
1079651600 11:22936122-22936144 ACCCTTTTCCTTGAGTCTGATGG + Intergenic
1079967022 11:26992451-26992473 AGACTTCTCATTTTCTCTGCAGG + Intergenic
1080297820 11:30750717-30750739 ACATTTCTCCTCGTATCTGAAGG - Intergenic
1080729119 11:34930247-34930269 CCACTTTTCCTTCACTCTGAAGG - Intronic
1080749963 11:35142148-35142170 ATGCATCTCCTTGTCTCTGTGGG + Intronic
1081886447 11:46501236-46501258 ACACTTCCCCATGTCTGTGTGGG + Intronic
1086881224 11:92155955-92155977 CTACTGCTCCTTTTCTCTGAAGG - Intergenic
1086894333 11:92294558-92294580 ACACCTATACTTGTCTCTCAAGG - Intergenic
1088373917 11:109119853-109119875 CCACTTCTCCTTCTCTCAAAAGG - Intergenic
1088567307 11:111185595-111185617 GCAGATCTCCTTGTCTCTGTAGG - Intergenic
1088623433 11:111710031-111710053 AGACTGCTCCTTCTCTATGAAGG - Intronic
1089823577 11:121250847-121250869 ACACTTGTGCTTGTTTCTTAGGG + Intergenic
1091061607 11:132468266-132468288 ACACCTCTCCTTCCCTCTGCAGG + Intronic
1096594595 12:52686582-52686604 GGATTTCTCATTGTCTCTGATGG + Intergenic
1097995209 12:65881246-65881268 CTCCTCCTCCTTGTCTCTGAGGG + Intronic
1098116495 12:67184359-67184381 GCACTTCTTTATGTCTCTGAGGG - Intergenic
1098134799 12:67390711-67390733 AGATTTCTTCTTGTCCCTGATGG + Intergenic
1098755540 12:74358167-74358189 ATAATTTTCCTTCTCTCTGAAGG - Intergenic
1099458613 12:82895318-82895340 ACTCTTGTGCTTGTCTCTAATGG - Intronic
1100006629 12:89902408-89902430 TCACTTCTCCATTTCTCTGTTGG - Intergenic
1100299835 12:93296831-93296853 ACAGTTTTCCTTGTATCTGTGGG - Intergenic
1100709169 12:97235742-97235764 ACACTTTTTCTGGTCTCTGTGGG - Intergenic
1101284856 12:103301311-103301333 TGACTTCTCTTTGTTTCTGAAGG + Intronic
1103804717 12:123563343-123563365 ACATTTCCGATTGTCTCTGAAGG - Intergenic
1103892189 12:124248183-124248205 CCACGTCTCCTTGTTTCTCAAGG - Intronic
1104160409 12:126173959-126173981 ACACATCTCCTTCCCTCAGAAGG + Intergenic
1105331080 13:19415888-19415910 ATACTTGTCCTTGTTTCTGTTGG + Intergenic
1105589715 13:21780432-21780454 ACAATGCACCTGGTCTCTGAAGG + Intergenic
1105724374 13:23147319-23147341 ACAGTTCTCCTTGAGTCTAAAGG + Intergenic
1106486881 13:30180107-30180129 ACAGGGCTCCTTGTCTCTCAGGG - Intergenic
1107396243 13:40021001-40021023 ACACCTTTCCTTTACTCTGAAGG - Intergenic
1109855173 13:68117723-68117745 ATGCTTATCCTTTTCTCTGAAGG + Intergenic
1110577700 13:77078978-77079000 ACTCTTCTGCCTGTCTCTTATGG + Intronic
1110745721 13:79051027-79051049 ACCCCTCTCCTAGTCTCTGTGGG - Intergenic
1113247842 13:108418738-108418760 ACACTTTTCCTTCTCACTCAAGG + Intergenic
1113602184 13:111577786-111577808 ACCCTACTGCTTCTCTCTGAGGG + Intergenic
1114015714 14:18427032-18427054 ACACTACTGCTAGGCTCTGAGGG - Intergenic
1114017596 14:18445435-18445457 ACACTGCTGCTTCTTTCTGAGGG - Intergenic
1114020966 14:18478319-18478341 ACACTGCTGCTGGTTTCTGAGGG - Intergenic
1114023193 14:18499811-18499833 ACACTTCTACTAGGGTCTGAAGG + Intergenic
1114023374 14:18501584-18501606 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1114024943 14:18516892-18516914 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1114025813 14:18525264-18525286 ACACTTCTTCGGGTCTCTGAAGG + Intergenic
1114026323 14:18530233-18530255 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1114544244 14:23486874-23486896 TCACTTCTCCCTTTCTCTCATGG + Intronic
1114717911 14:24847150-24847172 TCACTTATCCTTCTCTTTGATGG + Intronic
1116038255 14:39655497-39655519 CCTCTTCTCCATGGCTCTGAAGG - Intergenic
1117791506 14:59346600-59346622 AGACTTTTCCTTTTCTTTGATGG - Intronic
1117956696 14:61128726-61128748 ACACTGCTCCCTCTCCCTGAAGG + Intergenic
1120863662 14:89276960-89276982 ACCCTTCATCTGGTCTCTGATGG - Intronic
1122090964 14:99340214-99340236 ACACTCCTCCTTGAAGCTGAAGG - Intergenic
1124611646 15:31213791-31213813 GCAGTTCTCCCTTTCTCTGAGGG + Intergenic
1125082028 15:35686003-35686025 CCTATTCTCCTTTTCTCTGAAGG + Intergenic
1128220873 15:65967709-65967731 CCTCTTCTCCTTGTCACTGTGGG - Intronic
1128354514 15:66915459-66915481 TCTCTTCTCCTTGTCCCTGGAGG - Intergenic
1129436860 15:75548633-75548655 AAATTTCCCCTTGTCTCTAAAGG - Intronic
1130017245 15:80196987-80197009 ATCCTTCTCCTTGTCTCTCTAGG + Intergenic
1131379489 15:91952039-91952061 ACACTTATTATTGTCTCTGATGG + Intronic
1132324673 15:100958844-100958866 ACACTTCTCCGTTTCTCTCCCGG + Intronic
1132767137 16:1540074-1540096 ACACTGCTCCTCGCCACTGAGGG - Intronic
1133637007 16:7676753-7676775 ACATTTCTCCTTGTGTTTTAGGG + Exonic
1134876859 16:17708129-17708151 ACACTTCTCTTTGTCTGCAAAGG - Intergenic
1135187504 16:20327966-20327988 ACATTTCTGCTTCTGTCTGAAGG + Intergenic
1135967805 16:27050507-27050529 TCAATTCCCCTTGTATCTGAAGG - Intergenic
1137403317 16:48170971-48170993 ACACTTCTCTTTCTCTCATATGG - Intronic
1138166050 16:54802628-54802650 TCCGTTCTCCTTGTCTCTTAGGG - Intergenic
1138488684 16:57363512-57363534 ACAGATCTCCTTATCCCTGAAGG - Exonic
1139209827 16:65066224-65066246 AAACTTATCCTTGTCTTTTAAGG + Intronic
1139562876 16:67755020-67755042 ACACTTCTCCCCTCCTCTGAGGG + Intronic
1139593226 16:67944471-67944493 ACCCTTCCCTTCGTCTCTGATGG + Exonic
1142673387 17:1498004-1498026 ACACTTCTCCTTGTCTCTGAGGG - Exonic
1143087480 17:4426915-4426937 CCACTACTCTTTGGCTCTGAGGG + Intergenic
1148557439 17:48586960-48586982 CCACTCTTCCTTGTCTCTGGTGG - Intronic
1151091887 17:71449651-71449673 TAACTTCTTCTTGTCTCAGATGG - Intergenic
1151381272 17:73727356-73727378 TAAGTTCTCCCTGTCTCTGAAGG - Intergenic
1151444763 17:74156049-74156071 GCCCTTCTCCGTGTCTCAGAGGG + Intergenic
1151560538 17:74867349-74867371 ACATTTCTCCCCATCTCTGAGGG - Intronic
1153793116 18:8597681-8597703 ACACTTCCCCTTGTGTCAGGCGG + Intergenic
1155423602 18:25682482-25682504 AGACATTACCTTGTCTCTGAAGG - Intergenic
1157132471 18:45019831-45019853 ACACCTCTCATTCTCTCTGCCGG + Intronic
1157934574 18:51858880-51858902 ACACTTGTCTTTCTCACTGAAGG + Intergenic
1158031551 18:52971472-52971494 ACACCTCTCCCTGTATCTCAAGG - Intronic
1158051258 18:53223425-53223447 CCATTTCTGCTTGGCTCTGAAGG + Intronic
1158060026 18:53328924-53328946 AAACTTCTCCTTGTTCATGATGG + Intronic
1158651620 18:59293405-59293427 ACTCCTCTCCCTGTGTCTGATGG + Intronic
1163054944 19:14711048-14711070 AGAGTACTCCTTCTCTCTGAGGG + Intronic
1165647644 19:37456448-37456470 ACATTTCTACTTCTCTCTTAGGG + Intronic
1166322908 19:42029976-42029998 ACTCTTCTACTTGTCCCTTAAGG + Intronic
1167121092 19:47517213-47517235 TCACGTCTCCTTGGCTGTGATGG - Intergenic
1168234947 19:55056768-55056790 ACACTTCTCCATGTCTCGGCAGG + Exonic
926274553 2:11393781-11393803 ACTCTCCTCCTTGTCTCTGTTGG + Intergenic
926863022 2:17328655-17328677 ACACTAGCTCTTGTCTCTGAAGG - Intergenic
929781242 2:44958470-44958492 ACAATTCTATTTGTCTCTGATGG - Intergenic
934132372 2:88961071-88961093 ACACTGCACCATCTCTCTGATGG + Intergenic
934136828 2:89003976-89003998 ACACTCCACCATCTCTCTGATGG + Intergenic
940254335 2:151713261-151713283 ACCCTTCTCTTTTTCTGTGAGGG + Intronic
940385728 2:153069133-153069155 ACACATCTCCTGGACGCTGAAGG - Intergenic
941314280 2:163973149-163973171 ACACTCCTCCTTGTGTGTGGTGG - Intergenic
943417499 2:187627143-187627165 ACAATTCTGCTTGTCTGGGAAGG - Intergenic
944862355 2:203827198-203827220 TCACCTCTCCTTGCCTCTTATGG - Intergenic
946589564 2:221229583-221229605 ACACTTCTCTTTTTCTTTCAGGG - Intergenic
947084090 2:226431474-226431496 ACACTTGTCCTTGTGTCATATGG + Intergenic
947676754 2:231988545-231988567 AGACTTCTCCGTGACTTTGAGGG + Intronic
947709596 2:232304556-232304578 ACAAAGCTCCTTGTCTGTGAAGG - Intronic
948151070 2:235745370-235745392 ACATTTCTTGTTTTCTCTGAGGG + Intronic
948214820 2:236220862-236220884 ACACTTCTCCTTACCTCGAAAGG - Intronic
948883995 2:240874044-240874066 TCACTTGGCCTTGTCACTGAAGG - Exonic
1170594527 20:17794962-17794984 AAATTCCTCTTTGTCTCTGAGGG - Intergenic
1170975964 20:21165033-21165055 GCTCTTCTCCTTTGCTCTGAGGG + Intronic
1171480920 20:25455094-25455116 ACACATCTCCTCGTGTCTGGGGG - Intronic
1172652974 20:36517903-36517925 CCTCTTCTCATAGTCTCTGAAGG + Intronic
1175352760 20:58337036-58337058 ATACTTCACCTCTTCTCTGAAGG + Intronic
1175445223 20:59015315-59015337 TCTCTTGTCCTTGTTTCTGAAGG - Intergenic
1175456617 20:59120176-59120198 AACCTTCTCCTTGCTTCTGAGGG + Intergenic
1176338517 21:5621260-5621282 AGACCTCTCCTTGTCTGTGCAGG - Intergenic
1176339925 21:5684333-5684355 AGACCTCTCCTTGTCTGTGCAGG - Intergenic
1176472179 21:7116486-7116508 AGACCTCTCCTTGTCTGTGCAGG - Intergenic
1176495740 21:7498264-7498286 AGACCTCTCCTTGTCTGTGCAGG - Intergenic
1176504902 21:7640123-7640145 AGACCTCTCCTTGTCTGTGCAGG + Intergenic
1176741923 21:10612736-10612758 ATACTTGTCCTTGTTTCTGTTGG - Intergenic
1177972468 21:27807639-27807661 ACACCTCTGCTTTTCTCTGTAGG + Intergenic
1179825490 21:43963410-43963432 CGGCTCCTCCTTGTCTCTGATGG - Intronic
1180440223 22:15357905-15357927 ACACTACTGCTAGGCTCTGAGGG - Intergenic
1180442101 22:15376304-15376326 ACACTGCTGCTTCTTTCTGAGGG - Intergenic
1180445446 22:15408857-15408879 ACACTGCTGCTGGTTTCTGAGGG - Intergenic
1180447296 22:15426767-15426789 ACACTTCTACTAGGGTCTGAAGG + Intergenic
1180447470 22:15428492-15428514 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1180447540 22:15429115-15429137 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1180450446 22:15457286-15457308 ACACTGCTGCTGGTTTCTGAGGG + Intergenic
1180523218 22:16229651-16229673 ACACTGCTGCTGGTTTCTGAGGG - Intergenic
1180523268 22:16230178-16230200 ACACTGCTGCTAGGCTCTGAGGG - Intergenic
1180563803 22:16645973-16645995 ATACTTGTCCTTGTTTCTGTTGG - Intergenic
1181325453 22:22041918-22041940 TCCCTTCTCTTTGTCTCTGGTGG - Intergenic
1182376244 22:29850504-29850526 GCACTGTTCCTTCTCTCTGAAGG - Intergenic
949511357 3:4769899-4769921 ACACTTCTCCTGGGCAGTGAGGG - Intronic
949646941 3:6106137-6106159 ATACTTCTTCTGGTCTGTGATGG + Intergenic
949865454 3:8543261-8543283 CCACTTCTCACTGTCTCTGATGG + Intronic
951503010 3:23411392-23411414 AGCCTTCTCCTTTACTCTGATGG + Intronic
956835542 3:73093426-73093448 ACAGTTTTCCTTGTTACTGAGGG + Intergenic
958109287 3:89118946-89118968 AAAATTCTCCCTGTCTCTCAGGG - Intronic
959132778 3:102378315-102378337 ACAGTTTTCCTTGTCCCTGCAGG - Intronic
959363178 3:105421304-105421326 ACAATTCTCCTTTTCTATCAAGG - Intronic
960051437 3:113242482-113242504 CCTCTTCTCCTTGACTCAGATGG + Intronic
960499772 3:118423060-118423082 CCTCTTCTCTTTGTCTCTGGCGG - Intergenic
963766406 3:149340628-149340650 ACTCTTCTCCCTGTCTCAGTAGG - Intergenic
965874763 3:173302764-173302786 ATACTTCTCCTATTCTCTGCAGG - Intergenic
969108651 4:4827659-4827681 GCACCTCTCCTTGTCTTAGAAGG + Intergenic
971316748 4:25574040-25574062 TCTCATCTCCTTGTGTCTGATGG + Intergenic
973834150 4:54792485-54792507 ACACTCCACCTTGTCTCTTCTGG + Intergenic
974697710 4:65397190-65397212 GTACTTCTCCCTGGCTCTGATGG + Intronic
979574231 4:122267656-122267678 ACATTTCTATTTGTTTCTGATGG - Intronic
980239600 4:130156479-130156501 ACACTTTTCCTTGTATCTAAAGG - Intergenic
980273619 4:130619214-130619236 ACATTTCTTCTTGTCTCTTGTGG - Intergenic
981278289 4:142927713-142927735 ACACTCCTCCTTGTCTTGTATGG - Intergenic
982863251 4:160480854-160480876 ACACTTTTCCTACTCACTGATGG + Intergenic
985815160 5:2122905-2122927 ACAGTTCTGCTTGTCTCGGGAGG + Intergenic
986007591 5:3681042-3681064 TCACTTGTCCTTCCCTCTGATGG - Intergenic
986913962 5:12592697-12592719 TTACTTTTCATTGTCTCTGAAGG - Intergenic
988952893 5:36282809-36282831 CCTCTTCTCCTTGTGTTTGAGGG + Intronic
990534235 5:56704284-56704306 ACCCTTTTCCTTTTCTCTGCTGG + Intergenic
993280301 5:85917746-85917768 AAACTTTTCCTTGTCTGTAAAGG - Intergenic
995593366 5:113722970-113722992 ACACTTCTTCTTGTTTATCAGGG + Intergenic
997975485 5:138439367-138439389 CCACATCTCCATGTCTCTGGGGG - Intronic
1003052293 6:2790934-2790956 ACTCTTCTTCTTGGCTCTCAAGG - Intergenic
1004574441 6:16881335-16881357 ACCATTTTCCTTCTCTCTGAAGG + Intergenic
1005839923 6:29737573-29737595 AAACTTCTCCCTCTCTCTGATGG + Intronic
1005843156 6:29757845-29757867 TCACTTCTCCCTGTTTCTGCTGG + Intergenic
1006622656 6:35377061-35377083 ACACTTCTCCAAGGCTCTGTGGG - Intronic
1007846971 6:44767251-44767273 ACACATTTCCTTCTCTCAGAGGG - Intergenic
1011554034 6:88556402-88556424 AGCCTTCTCCTTGTCTCTGCTGG - Intergenic
1011935623 6:92773262-92773284 ACAGTTTTCATTGTCTTTGAAGG - Intergenic
1012306415 6:97663522-97663544 ACACTTCTCCTTGCCTGTCCAGG + Intergenic
1015424459 6:133049599-133049621 ACACTTCTCTGTGTCATTGATGG + Intergenic
1016048427 6:139504610-139504632 ACACTTCTCTTTCTCTTGGATGG - Intergenic
1016325489 6:142896559-142896581 ACACTTGGAATTGTCTCTGAAGG - Intronic
1016757957 6:147707790-147707812 ACCTTTCTCCTTGCCTCTGGTGG + Intronic
1016794472 6:148103366-148103388 ACACGTTTCCTTTTCTCTGCAGG + Intergenic
1016868991 6:148798258-148798280 ACTCCTCCCCTTGGCTCTGAGGG - Intronic
1017578637 6:155835057-155835079 ACCATTCTCTTTGTCTTTGAGGG + Intergenic
1018067164 6:160132210-160132232 CCATGTCTCCTTCTCTCTGAAGG + Exonic
1018170266 6:161138846-161138868 ACCCTGCTCCTTGCCTCTGGCGG - Intronic
1020181958 7:5929522-5929544 ACAGCTATCCTTGTCTCTAAAGG - Intronic
1020300976 7:6795414-6795436 ACAGCTATCCTTGTCTCTAAAGG + Intronic
1020632300 7:10653791-10653813 ACTCTCCTCCTTGTCTGTAAAGG - Intergenic
1020817886 7:12928468-12928490 CCACTTTTCCTTGTGTCAGAGGG - Intergenic
1021994526 7:26166856-26166878 ACACTGTTCTTTGTCTTTGAAGG + Intronic
1026774072 7:73220430-73220452 ACCCTTTTCCTTGTCCCTGCAGG + Intergenic
1026881470 7:73909194-73909216 ACACTTGGCCGTGTCTCTGGTGG + Intergenic
1027014929 7:74773816-74773838 ACCCTTTTCCTTGTCCCTGCAGG + Intergenic
1027073102 7:75172137-75172159 ACCCTTTTCCTTGTCCCTGCAGG - Intergenic
1027623329 7:80519717-80519739 AAACTGATCCTTTTCTCTGAGGG + Intronic
1028042222 7:86067475-86067497 ACATTTTTCCTTCTTTCTGATGG - Intergenic
1028906812 7:96163576-96163598 ACACTTCTCCTCCTCAATGATGG + Intronic
1030004266 7:105100080-105100102 TCACTTCTCCTAGTCTGGGACGG - Intronic
1030700319 7:112631188-112631210 ACCCTCCTCCATTTCTCTGAAGG - Intergenic
1030867891 7:114721784-114721806 ACAGCTCTCCTTTTCTCTGGAGG + Intergenic
1030883206 7:114906089-114906111 AAACTCTTCTTTGTCTCTGACGG + Intergenic
1035443076 7:158920140-158920162 ACACTTCACATGTTCTCTGACGG - Intronic
1036226869 8:6966733-6966755 AAACTTCCCTTTGTCACTGAGGG - Intergenic
1036436226 8:8736406-8736428 ACATTTCTCCCTGTATCTCATGG - Intergenic
1036769314 8:11567661-11567683 AGACCTCTCCTTGCCTGTGAAGG + Intergenic
1038998341 8:32951187-32951209 ACACTTCTCTTTCTCTCGCAAGG + Intergenic
1039186831 8:34926855-34926877 ACACTTCTCTTTGTGTCAGGTGG + Intergenic
1040376229 8:46827181-46827203 CCAAATCTCCTTGTCTTTGAGGG - Intergenic
1041294465 8:56340227-56340249 AGTCTTTTCCTTGTCACTGAAGG + Intergenic
1042321700 8:67482340-67482362 TCACTTTCCCTTCTCTCTGATGG - Intronic
1042495885 8:69454189-69454211 ACACTTGTCTCTGTCTATGAGGG + Intergenic
1049935435 9:497373-497395 CCAGTTCACCTTTTCTCTGAGGG + Intronic
1050348842 9:4720161-4720183 ACACATCTCTTTGTCTGTTAGGG - Intronic
1050672611 9:8014989-8015011 AAACTTCTCCTTGTTTCTTGAGG + Intergenic
1052475408 9:28952762-28952784 GCACTTCTACTTATCTCTGCTGG - Intergenic
1053717455 9:40911184-40911206 ACACTGCTGCTTGAGTCTGAAGG + Intergenic
1054075512 9:60525231-60525253 ACACTGCTGCTTGAGTCTGAAGG - Intergenic
1054091626 9:60853936-60853958 AGACTTTTCTTTGTCTCTAAAGG + Intergenic
1054113041 9:61129510-61129532 AGACTTTTCTTTGTCTCTAAAGG + Intergenic
1055020879 9:71668347-71668369 ACCCCTCTCCTGGTTTCTGACGG + Intergenic
1058067160 9:100562527-100562549 AAAGTTCTCCTTGTCTTTGAAGG + Intronic
1059259587 9:112962947-112962969 GTACTTCTCCTTTTCTCTTATGG - Intergenic
1059770892 9:117424031-117424053 AAAATTCTCCAAGTCTCTGAAGG + Intergenic
1060243492 9:121925310-121925332 ACTCATCTCCTGGGCTCTGAGGG - Intronic
1061740105 9:132696659-132696681 TCAGTTCACCTTTTCTCTGAAGG - Intergenic
1061794409 9:133077068-133077090 AGGCTTCTCCTTGTCTTAGAGGG + Intronic
1203423142 Un_GL000195v1:13660-13682 AGACCTCTCCTTGTCTGTGCAGG + Intergenic
1203456146 Un_GL000219v1:169576-169598 ACACTGCTGCTTGAGTCTGAAGG - Intergenic
1189705517 X:43755615-43755637 CCCCTTCTCCCTGTCTCAGAGGG - Intergenic
1190760366 X:53433591-53433613 ACCCATCTCCTTGTCTCTTTTGG - Intronic
1194899487 X:99491328-99491350 ATACTTCTTCTTGTTTCTCAGGG + Intergenic
1195109159 X:101628351-101628373 ACTCTGCACCTTCTCTCTGAAGG - Intergenic
1199465432 X:148130384-148130406 CAACTGCTCCTTGCCTCTGAAGG - Intergenic
1200855556 Y:7934237-7934259 CCAATTCCCCTTGTCTTTGAGGG + Intergenic
1200867723 Y:8063038-8063060 ACAAATCTCCTTGTCTTTGATGG - Intergenic
1202600247 Y:26586923-26586945 ATACTTGTCCTTGTTTCTGTTGG - Intergenic