ID: 1142673387

View in Genome Browser
Species Human (GRCh38)
Location 17:1498004-1498026
Sequence ACACTTCTCCTTGTCTCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 245}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673387_1142673396 4 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673396 17:1498031-1498053 CCGGCGGTATGGGAGTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1142673387_1142673397 14 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673397 17:1498041-1498063 GGGAGTGTCGGGGCCAGCACAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1142673387_1142673393 2 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673387_1142673394 3 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673387_1142673391 -7 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673387_1142673392 -6 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673387_1142673398 15 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673387 Original CRISPR ACACTTCTCCTTGTCTCTGA GGG (reversed) Exonic