ID: 1142673388

View in Genome Browser
Species Human (GRCh38)
Location 17:1498005-1498027
Sequence CACACTTCTCCTTGTCTCTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673388_1142673398 14 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188
1142673388_1142673397 13 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673397 17:1498041-1498063 GGGAGTGTCGGGGCCAGCACAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1142673388_1142673392 -7 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673388_1142673394 2 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673388_1142673393 1 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673388_1142673391 -8 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673388_1142673396 3 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673396 17:1498031-1498053 CCGGCGGTATGGGAGTGTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673388 Original CRISPR CACACTTCTCCTTGTCTCTG AGG (reversed) Exonic
900861541 1:5236342-5236364 CAACCTCCTCCTTGTCTCTCTGG - Intergenic
901638954 1:10683670-10683692 CGCACTCCGACTTGTCTCTGTGG - Intronic
903176771 1:21586222-21586244 TGTTCTTCTCCTTGTCTCTGGGG + Intergenic
903885769 1:26540182-26540204 CCAACATCCCCTTGTCTCTGTGG + Intronic
904334735 1:29789611-29789633 CTCCCTTCTCCTTGTCCTTGAGG - Intergenic
904490537 1:30856215-30856237 CACTCTTCTCTCTGTCTCAGGGG - Intergenic
905908116 1:41633214-41633236 CACATTTCTCCTTTTATTTGAGG - Intronic
906243323 1:44256105-44256127 CTCGCTTCTCCTTTTCTCAGTGG - Intronic
906724091 1:48031038-48031060 CAGACTTCTCTCTGTTTCTGGGG + Intergenic
907808641 1:57846044-57846066 CACTCTTCCCTCTGTCTCTGGGG - Intronic
908966781 1:69774540-69774562 CTCACTTTTCTTTGTTTCTGTGG - Intronic
910490648 1:87765681-87765703 TGCACTTGTCCTTGTCTCAGAGG + Intergenic
912446064 1:109737683-109737705 AACAATTCTCCATGTTTCTGGGG - Exonic
914703903 1:150156101-150156123 CACACTTCTCATAGTCACTCAGG - Exonic
915623182 1:157098616-157098638 CACCCTCCTCTTTGCCTCTGGGG - Intronic
915749179 1:158188753-158188775 CACATTTCTCTTTGCCTCAGGGG + Intergenic
915893660 1:159794442-159794464 CACTCTTCCCTTTGTCTCAGAGG - Intergenic
916005584 1:160656612-160656634 CATTCTGCTCCATGTCTCTGAGG - Intergenic
916277059 1:163006519-163006541 CTCACTTCTCCGAGTCTCTGTGG + Intergenic
916359265 1:163949811-163949833 CAGAATCCTCCTAGTCTCTGGGG + Intergenic
917173678 1:172206950-172206972 CACATTTCTCTTTGTCCATGAGG + Intronic
917700885 1:177579786-177579808 CAAAGTTCACCTTCTCTCTGAGG + Intergenic
918146320 1:181759012-181759034 CACACATCATCTTGTCTCTACGG - Intronic
918387980 1:184029736-184029758 CTCTCTTGTCCTTGTCTCTCTGG - Intronic
919265468 1:195258599-195258621 CAAATCTCTCCTTCTCTCTGTGG - Intergenic
919881210 1:201902363-201902385 CAAACTTCTCAGTGTCTCGGGGG - Intronic
920192145 1:204200691-204200713 CACACTTCCCAAAGTCTCTGAGG + Intronic
921476391 1:215615800-215615822 GACACTTTTCCTTGTGTCTTTGG - Intronic
923636310 1:235700630-235700652 CATACTGCTTCTTGACTCTGTGG - Intronic
923926636 1:238636039-238636061 CATTCTTCTTCTTGACTCTGTGG + Intergenic
924202248 1:241672382-241672404 CACACTTCTCCCCTGCTCTGGGG - Intronic
1063887020 10:10589898-10589920 GACACTGCTCCTGGTATCTGAGG - Intergenic
1064252892 10:13720389-13720411 CAGACTCCTCCTTATGTCTGTGG - Intronic
1064422983 10:15206181-15206203 CACTTTTCTCTTTGTTTCTGGGG - Intergenic
1067455090 10:46413417-46413439 CACTCTTCTCCATGACTTTGAGG - Intergenic
1067632114 10:47971217-47971239 CACTCTTCTCCATGACTTTGAGG + Intergenic
1067771646 10:49130928-49130950 CATCCTTCTCCCTGTCTCAGGGG - Intergenic
1071767982 10:88690173-88690195 CACATTTCTCTGTCTCTCTGGGG - Intergenic
1071797430 10:89021520-89021542 CACACTTCTCTTTTTCTTTTTGG - Intergenic
1072560637 10:96570713-96570735 GTCTCTTCTCTTTGTCTCTGTGG - Intronic
1073323641 10:102630240-102630262 CACACTTGTCCTTTTATTTGTGG - Exonic
1073428693 10:103472003-103472025 CACACTCCTACTTTGCTCTGAGG + Intergenic
1074783121 10:116816435-116816457 CACTCTTCACCTTTTCTCCGAGG + Intergenic
1074881772 10:117665126-117665148 CACACCTTTCCTTTGCTCTGCGG + Intergenic
1077521525 11:3038301-3038323 CACACTTCTCTATCTCTATGGGG - Intronic
1077605081 11:3604285-3604307 CCCTCTTGTCCTTCTCTCTGTGG + Intergenic
1079142772 11:17823785-17823807 CACAATTCTCCTGCTCTTTGAGG + Intronic
1079539048 11:21550055-21550077 GACCCCTCTCCTAGTCTCTGTGG - Intronic
1080749962 11:35142147-35142169 CATGCATCTCCTTGTCTCTGTGG + Intronic
1081270750 11:41079319-41079341 CACCCTCCTTCTTGTCTCTCTGG - Intronic
1081886446 11:46501235-46501257 CACACTTCCCCATGTCTGTGTGG + Intronic
1084684495 11:70685772-70685794 CACAAGTCTCCTTCTCACTGGGG + Intronic
1087906507 11:103703819-103703841 CACACTGCTGCTTCTCACTGAGG - Intergenic
1089823576 11:121250846-121250868 CACACTTGTGCTTGTTTCTTAGG + Intergenic
1091071019 11:132563440-132563462 CACAATTCACCTTCTCTTTGGGG + Intronic
1091493208 12:950230-950252 CGCACTTCTCCATTTCCCTGCGG - Intronic
1091889042 12:4038397-4038419 CACACATCACCTGGTCCCTGGGG + Intergenic
1091954701 12:4628745-4628767 TACTCTTCTCCAGGTCTCTGCGG + Exonic
1092672150 12:10875685-10875707 CACTATTCTACTTGGCTCTGTGG - Intronic
1093758487 12:22879225-22879247 CCCACTTTTCCTTTTATCTGGGG - Intergenic
1095328608 12:40929250-40929272 CATACTTTTCCCTGTTTCTGTGG + Intronic
1095861889 12:46926338-46926360 GACAATTATCCTTGTCCCTGTGG - Intergenic
1096561337 12:52437921-52437943 CAGACTTCTCCTACTCTCTGTGG + Intergenic
1099305682 12:80952171-80952193 CACACTTCCCATTGACTCAGTGG - Intronic
1100080980 12:90849715-90849737 CAGAGTTGTCTTTGTCTCTGTGG - Intergenic
1100274319 12:93058103-93058125 CACCTTCCTCCATGTCTCTGTGG - Intergenic
1100299836 12:93296832-93296854 GACAGTTTTCCTTGTATCTGTGG - Intergenic
1100709170 12:97235743-97235765 AACACTTTTTCTGGTCTCTGTGG - Intergenic
1101524039 12:105511466-105511488 CAGTCATCTCCTTTTCTCTGAGG + Intergenic
1103629086 12:122244945-122244967 CACAGTTCTCATTATCTTTGGGG + Intronic
1104160389 12:126173640-126173662 CACCCTTCTCGGTGTCACTGAGG - Intergenic
1104351726 12:128049802-128049824 CACACATCACCTTGTCTATGAGG - Intergenic
1104478863 12:129090262-129090284 CACAGTTCTCCTTGCTTCAGGGG + Intronic
1104653689 12:130557232-130557254 CAGGCCTCTCCCTGTCTCTGTGG - Intronic
1105995244 13:25665012-25665034 CACACTGCTCCTGGTCTCGACGG - Intronic
1106004266 13:25753814-25753836 CAGACTTTTCCTTAACTCTGGGG - Intronic
1106046982 13:26151864-26151886 CCCTCTTCTCCATTTCTCTGGGG + Intronic
1106486882 13:30180108-30180130 CACAGGGCTCCTTGTCTCTCAGG - Intergenic
1106768343 13:32938469-32938491 CACACTTTTGTTTGACTCTGAGG - Intergenic
1107890452 13:44909893-44909915 CCCACTTCTCTGTCTCTCTGGGG + Intergenic
1110711246 13:78653329-78653351 CACACTGCCCCATGTCCCTGGGG + Intronic
1110745722 13:79051028-79051050 CACCCCTCTCCTAGTCTCTGTGG - Intergenic
1116001068 14:39243305-39243327 CACATTTCTCATTGTATCTGGGG + Intronic
1119246776 14:73116550-73116572 CACATTTCTCCTTTCCTCTGAGG - Intronic
1119598984 14:75961909-75961931 CATACTTCTCCTTGTCTGATGGG - Intronic
1121965438 14:98299327-98299349 CAGAGTCCTCCATGTCTCTGAGG - Intergenic
1122252928 14:100453017-100453039 ACCACTTCTCCTTGCCTCTGTGG - Intronic
1122469700 14:101957987-101958009 CACACTTCTCCTGGCCTCAATGG + Intergenic
1125443211 15:39725442-39725464 CACACTGCTCCTTTCCCCTGAGG + Intronic
1125758874 15:42083872-42083894 CACACAACTCCTTGTGTGTGTGG - Intronic
1127085432 15:55420134-55420156 GACACTTCTCCTGATCTCTCTGG - Intronic
1128039642 15:64560033-64560055 CACCCTTCCTCTTGTCTCTCTGG + Intronic
1128220875 15:65967710-65967732 TCCTCTTCTCCTTGTCACTGTGG - Intronic
1128284514 15:66425184-66425206 CAGACTTTGCCTTGTATCTGCGG + Intronic
1128411140 15:67399094-67399116 CACCCTTCTCCACCTCTCTGTGG + Intronic
1130166430 15:81464991-81465013 CCAATTTCTCCTTGTCTCTAAGG + Intergenic
1130298578 15:82663907-82663929 GACGCTTCTCCTTTTCTCTCTGG + Exonic
1130995025 15:88898873-88898895 GACACTTCCCCTTGTCTCCCTGG - Exonic
1131990328 15:98086933-98086955 CAACTTTCTCCTTGTTTCTGTGG - Intergenic
1132750715 16:1456170-1456192 CCCGCTTCTCTGTGTCTCTGCGG + Exonic
1132767138 16:1540075-1540097 CACACTGCTCCTCGCCACTGAGG - Intronic
1132981211 16:2739509-2739531 GCCCCTTCTCCTTGTGTCTGGGG + Intergenic
1133637006 16:7676752-7676774 CACATTTCTCCTTGTGTTTTAGG + Exonic
1136096698 16:27962131-27962153 CACACTCCCCCGTGTCCCTGTGG + Intronic
1136235694 16:28912276-28912298 CCCATTTCTTCCTGTCTCTGCGG + Intronic
1136344026 16:29663734-29663756 CACGCTTCTCCTTCTCCTTGGGG + Exonic
1137298376 16:47120791-47120813 AACTTTTCTCCTTGTCTGTGGGG + Intronic
1137763838 16:50962315-50962337 CACCCTTTTCCTTTTCTGTGTGG + Intergenic
1138166051 16:54802629-54802651 CTCCGTTCTCCTTGTCTCTTAGG - Intergenic
1140877362 16:79164903-79164925 CACACTTTGCCTCTTCTCTGTGG - Intronic
1141995126 16:87632031-87632053 AAGGCTTCTCCTTGTGTCTGAGG + Intronic
1142673388 17:1498005-1498027 CACACTTCTCCTTGTCTCTGAGG - Exonic
1143087478 17:4426914-4426936 CCCACTACTCTTTGGCTCTGAGG + Intergenic
1143634962 17:8159337-8159359 CACACTTCTGGTTTTCTGTGTGG - Exonic
1144484128 17:15651084-15651106 CACTCACCTCCTTGTCCCTGCGG + Exonic
1147000428 17:37358786-37358808 CAGACCTCTCCATGTCTCTAGGG + Intronic
1148035376 17:44656250-44656272 CCTTCCTCTCCTTGTCTCTGGGG + Intergenic
1148460931 17:47838643-47838665 TACCACTCTCCTTGTCTCTGAGG + Exonic
1149626637 17:58084299-58084321 CACACTTCTACTTCCCTCTTCGG - Intronic
1150536410 17:66046884-66046906 GAAAATTCTTCTTGTCTCTGTGG - Intronic
1150562834 17:66309630-66309652 CACGCTTGTCTTTATCTCTGAGG - Intronic
1150613255 17:66749985-66750007 GAGACTTCTCCTGGCCTCTGGGG + Intronic
1151560539 17:74867350-74867372 CACATTTCTCCCCATCTCTGAGG - Intronic
1155187380 18:23399198-23399220 CAAACTACTCCTTGCTTCTGAGG - Intronic
1157786410 18:50487254-50487276 CACAGTTTTCCCTGTCTCTTTGG - Intergenic
1158170074 18:54587780-54587802 CAAAATTTTCCTTGTCTCTCTGG - Intronic
1158250822 18:55485558-55485580 CTCACCTCTCCTGGTCCCTGTGG + Intronic
1158520704 18:58169844-58169866 CAGACCTCTCCCTGTCTCTGGGG + Intronic
1159695537 18:71552605-71552627 CAAACTTCTACATATCTCTGGGG - Intergenic
1159766875 18:72502405-72502427 CACACATTTCCTCCTCTCTGAGG - Intergenic
1160535089 18:79587341-79587363 CCCACATCTCCTGGGCTCTGCGG - Intergenic
1160967374 19:1752678-1752700 CAAACTCCTCTTTGTCCCTGGGG - Exonic
1161011822 19:1963143-1963165 CACGTTACTCCCTGTCTCTGTGG - Intronic
1162850514 19:13427673-13427695 CACACATCTCCTTGGATCTTTGG - Intronic
1162877551 19:13631944-13631966 CACAATTCTCCCTGTGTCTGTGG - Intergenic
1164312565 19:24059133-24059155 CACACATCACCTTGGCGCTGGGG - Intronic
1164586912 19:29481433-29481455 CATACTCCTCCTTGTGTCTGTGG - Intergenic
1166684057 19:44784623-44784645 CACACTTCTCCTCGGAGCTGTGG - Intronic
925326556 2:3026553-3026575 CACACCTCTGCCTGTCTTTGTGG - Intergenic
926408754 2:12580294-12580316 AACACCTCTTCTTTTCTCTGGGG - Intergenic
927569751 2:24148459-24148481 CAAACTTGACCTTGTATCTGTGG + Intronic
927811533 2:26183130-26183152 CACACTACTCCTTGCCTCAGGGG + Intronic
927974682 2:27329263-27329285 CAGCCATTTCCTTGTCTCTGCGG - Exonic
928027991 2:27755362-27755384 CCCAGTTCTCCTAGTCTCTCTGG - Intergenic
928429443 2:31205556-31205578 CATCCTTCCCCTCGTCTCTGTGG - Intronic
929897068 2:45969867-45969889 CACATTTCTCCAGGTTTCTGTGG + Intronic
932109704 2:68986740-68986762 AACACTTCTCCTCATCTCAGGGG - Intergenic
940403176 2:153269733-153269755 CACACTTCTTCATGGCTCAGGGG + Intergenic
940900360 2:159121233-159121255 CTCACCTCTCATTGGCTCTGTGG + Intronic
941110542 2:161415610-161415632 CCCCCTTCTGCTTGTCGCTGTGG + Intergenic
941751319 2:169137812-169137834 CACCATTATCCTTTTCTCTGTGG - Intronic
946589565 2:221229584-221229606 CACACTTCTCTTTTTCTTTCAGG - Intergenic
946739181 2:222785155-222785177 CACTGTCCACCTTGTCTCTGAGG - Intergenic
947005734 2:225509135-225509157 AACACTTCCACTTGTCTCAGTGG + Intronic
947280711 2:228450818-228450840 CACACTTCTACATGGCTGTGTGG - Intergenic
947299584 2:228674193-228674215 CACAGTTCTCCTTGAGTCTTTGG - Intergenic
948107936 2:235430110-235430132 CACTGTTCTCCTTTTCTCGGCGG + Intergenic
948151069 2:235745369-235745391 CACATTTCTTGTTTTCTCTGAGG + Intronic
948214137 2:236216114-236216136 CACCCCCCTCCTTTTCTCTGCGG + Intronic
948938102 2:241181550-241181572 CACAGCTCCCCTTCTCTCTGGGG - Intronic
1168815273 20:732502-732524 CACACATCTCCAGGACTCTGGGG - Intergenic
1168912542 20:1460987-1461009 CAGACTTCGCCTTGAATCTGTGG + Intronic
1169052881 20:2595527-2595549 CCCAACTCTACTTGTCTCTGTGG + Intronic
1170975963 20:21165032-21165054 CGCTCTTCTCCTTTGCTCTGAGG + Intronic
1171009627 20:21501732-21501754 AACATTTCTCCTTGTTTCTGAGG + Intergenic
1171426428 20:25051406-25051428 CAGACCTCTTCTTGTCTTTGTGG + Intronic
1171474010 20:25393630-25393652 CACACCTCTCCTTGACCCTTAGG + Intergenic
1171480921 20:25455095-25455117 CACACATCTCCTCGTGTCTGGGG - Intronic
1173715769 20:45204053-45204075 CATACATCTCCATGTCTTTGGGG + Intergenic
1175196646 20:57248419-57248441 AAGACTTCTCCTTGTCTCTTGGG - Intronic
1175456616 20:59120175-59120197 CAACCTTCTCCTTGCTTCTGAGG + Intergenic
1176097632 20:63351643-63351665 AACACCTGTCCTTGCCTCTGTGG - Intronic
1178284230 21:31311709-31311731 CACACCTCTCATTGTCTTTCTGG - Intronic
1179146916 21:38776036-38776058 CCCATTTCTCCTTTTCCCTGAGG + Intergenic
1179582021 21:42350074-42350096 CACACTGCTCCTTCTCTCAGAGG + Intronic
1179891285 21:44336217-44336239 CACATTTCTCCTTCAGTCTGCGG - Intronic
1180120091 21:45740108-45740130 CTCTCTTCTCCTTAACTCTGAGG - Intronic
1180875473 22:19173180-19173202 CTCCCTTTTCCTTTTCTCTGAGG + Intergenic
1181741809 22:24927149-24927171 CAGACTTCTTCATGTGTCTGTGG + Intronic
1182062342 22:27407257-27407279 CGCATCTCTCCCTGTCTCTGTGG - Intergenic
1182440426 22:30360555-30360577 CACAGATCTCCTTGTTTCTTTGG - Intronic
1183010502 22:34942704-34942726 CATACATCTGCTTGTCTATGTGG + Intergenic
1184495663 22:44839835-44839857 CACACTTCTCCTGGTGTTTGTGG + Intronic
1184788031 22:46681170-46681192 CACACTGCCCCCTGTCTGTGTGG - Intergenic
949511358 3:4769900-4769922 CACACTTCTCCTGGGCAGTGAGG - Intronic
951782680 3:26381923-26381945 TTCCCTTCTCCTTGACTCTGGGG - Intergenic
952497680 3:33930075-33930097 CACACTTACCTTTGTCTATGGGG + Intergenic
952691153 3:36208158-36208180 CCCACTTCTGCTTCTCTGTGAGG + Intergenic
952710738 3:36429670-36429692 CCCACTTCTCCTTGCCTCCTCGG + Intronic
954786953 3:53100750-53100772 CTGATTTCTCTTTGTCTCTGAGG + Intronic
955240509 3:57173931-57173953 GAAACTTCTCCTTGTCTCCTAGG - Intergenic
955409913 3:58648857-58648879 CCCACTTCTGTTTGTCTCTGGGG + Intronic
956152417 3:66257717-66257739 CACACTATTCCTTGACCCTGTGG + Intronic
958113739 3:89186272-89186294 CACCCTTTACCTTGTCTTTGAGG + Intronic
960021248 3:112956501-112956523 CATACATCTCCATGTCTTTGTGG + Intronic
960698661 3:120419634-120419656 CTCACTTCTCATAGTCGCTGTGG - Intronic
965241149 3:166200050-166200072 CTCACTTCTTCTGGTCTATGTGG + Intergenic
965410480 3:168324296-168324318 CAAACTTCTCCTGTTCTATGAGG + Intergenic
965443624 3:168746929-168746951 CACACCTCTCCTTCTCCCAGTGG + Intergenic
965864897 3:173194586-173194608 CAAACTTCTCCTTGTCAGGGAGG - Intergenic
968977079 4:3827632-3827654 CCCACTTCTCCTGGGCTTTGGGG + Intergenic
969687331 4:8683039-8683061 CACCCTTTTCCCTTTCTCTGTGG + Intergenic
970109202 4:12618453-12618475 CACACTCCACTCTGTCTCTGTGG + Intergenic
970369225 4:15391150-15391172 CTCAGTTCTGCTTGTCTCTGAGG + Intronic
972168991 4:36322022-36322044 GAAACTTCACCTTCTCTCTGTGG + Intronic
977258759 4:94771426-94771448 CACATGTCTCCTTGCCTCAGGGG - Intronic
977858205 4:101921976-101921998 TACACTGCTCTTTGTCCCTGTGG + Intronic
979978444 4:127225076-127225098 CACACTGTTCCTTCTCTCCGTGG + Intergenic
983441428 4:167791381-167791403 CTCACTACTCTCTGTCTCTGTGG + Intergenic
984226382 4:177040171-177040193 GACACTCTTCCTGGTCTCTGTGG + Intergenic
985493171 5:190985-191007 CACACTTCGCCTCGCATCTGGGG - Intergenic
985635056 5:1031794-1031816 CACACTGCCCCTTTGCTCTGGGG - Intronic
985744422 5:1638129-1638151 CACAGGTCTCCCTGTCTGTGGGG - Intergenic
987238615 5:15969401-15969423 TACACTACTCCTTTTATCTGTGG + Intergenic
988616437 5:32779551-32779573 CACAATTCTTCTGGTCTCTTTGG + Intronic
989463381 5:41726665-41726687 CACACTTTGCTTTGTCTTTGTGG - Intergenic
989701762 5:44275188-44275210 GACATTTCTCATTGTCTCTGAGG + Intergenic
990325029 5:54666736-54666758 CTGTCTTCTCTTTGTCTCTGTGG + Intergenic
990780698 5:59358751-59358773 TACTCTTCTGCTTGTCTTTGTGG - Intronic
995387519 5:111604210-111604232 CACTCCTCCACTTGTCTCTGTGG + Intergenic
995651264 5:114371016-114371038 CCCACTTCTCCTCATCTCTATGG - Intronic
997212442 5:132085398-132085420 CCCACTTCTCTTTGTCTTTATGG + Intergenic
997975487 5:138439368-138439390 GCCACATCTCCATGTCTCTGGGG - Intronic
998941403 5:147286781-147286803 CACAGTTCCCCTTGTCCTTGAGG + Intronic
999702117 5:154237657-154237679 CAGACTTCACCTTGTTTTTGAGG + Intronic
999940970 5:156542654-156542676 CAAATTACTCCATGTCTCTGAGG - Intronic
1000168492 5:158678520-158678542 CTCTCTTCTCCCAGTCTCTGAGG + Intergenic
1000955242 5:167535323-167535345 TAGACTTCTCCTTGTCTCTAAGG - Intronic
1001600606 5:172925876-172925898 CACATCTCACCTTTTCTCTGAGG - Intronic
1002639093 5:180622183-180622205 CCCACTTCCTCTTGTCTCTCTGG + Intronic
1004317402 6:14601715-14601737 CACCCTTTTCATTGACTCTGTGG + Intergenic
1004944915 6:20601769-20601791 CACACATCTCCCAATCTCTGCGG - Intronic
1005351828 6:24943679-24943701 CACACTTCACCTTATCTCTGTGG + Intronic
1005813172 6:29531359-29531381 CTCACGTCTCATTGTCTCTGAGG - Intergenic
1006622657 6:35377062-35377084 AACACTTCTCCAAGGCTCTGTGG - Intronic
1007075905 6:39065934-39065956 CATCCATCTCCTTGCCTCTGGGG + Intronic
1009452530 6:63818513-63818535 CACCCTTCTCCTTCTCCCTGAGG + Intronic
1010445016 6:75939786-75939808 CAACTTTCTCCCTGTCTCTGTGG + Intronic
1012769654 6:103415421-103415443 CACATATCTCAGTGTCTCTGTGG - Intergenic
1013743634 6:113318890-113318912 CCCAGTTCTCCTGGCCTCTGGGG - Intergenic
1014477685 6:121894376-121894398 CAATGTTCTCATTGTCTCTGGGG + Intergenic
1015248666 6:131104048-131104070 CTCTCTTCTCAGTGTCTCTGAGG + Intergenic
1016868992 6:148798259-148798281 CACTCCTCCCCTTGGCTCTGAGG - Intronic
1017861019 6:158397305-158397327 CACACTTCTCCTTTCCTGTCAGG + Intronic
1018067417 6:160133734-160133756 CACGCCTCCCCTTCTCTCTGGGG - Intronic
1018926683 6:168211611-168211633 CACCCTCCTTTTTGTCTCTGTGG + Intergenic
1019158856 6:170056447-170056469 CACACTGCTGCCTGGCTCTGCGG - Intergenic
1021293232 7:18871416-18871438 AACTCTGCTCCTTGTCACTGGGG + Intronic
1022327409 7:29344692-29344714 TACTCTTCTCTTTGTCTTTGGGG + Intronic
1023514321 7:40985550-40985572 CACACTTCTCCTTATCTTCCAGG - Intergenic
1024228184 7:47344412-47344434 CACACTTCACGTTCTCTGTGGGG - Intronic
1024311882 7:47977152-47977174 CACACTCACCCTGGTCTCTGTGG - Intronic
1024492706 7:50003743-50003765 GCCACTTTTCCTTGTCTCTGTGG - Intronic
1024642536 7:51341956-51341978 CCCACCTCCCCTTCTCTCTGGGG + Intergenic
1026126738 7:67586102-67586124 AACATTTTTCCCTGTCTCTGGGG - Intergenic
1028451402 7:90988849-90988871 CACACCTTTCCTTGTCTCCTGGG + Intronic
1028508703 7:91597968-91597990 CACATTTCTCCTGGTTTCAGTGG + Intergenic
1029163436 7:98569246-98569268 CCTATTTCTCCTTGTTTCTGAGG - Intergenic
1030326893 7:108229446-108229468 CATTCTTCACCTTGTCCCTGGGG + Intronic
1030947372 7:115740402-115740424 CACTGTTCTTCTTGTTTCTGTGG - Intergenic
1031712168 7:125062279-125062301 CAGACTTCTCCTTTTCTTTGGGG + Intergenic
1033481838 7:141749940-141749962 CACTTTTGTCCTTTTCTCTGAGG + Intronic
1033563241 7:142554024-142554046 CACACTTCTCCTTATCTGAGTGG - Intergenic
1036426554 8:8650097-8650119 CACAGCTCTCCTTGTGTTTGGGG - Intergenic
1036521442 8:9495037-9495059 AATGCTTCTCCTTATCTCTGTGG - Intergenic
1036716238 8:11126784-11126806 CTAACATCTCCTGGTCTCTGAGG - Intronic
1038387218 8:27159888-27159910 CACACATCTATTTGTATCTGTGG - Intergenic
1038432108 8:27508634-27508656 CTCACTTCTCTTTGTCTCAGGGG + Intronic
1038804584 8:30778571-30778593 CAAACTTCTCCTTGTGTCCATGG - Intronic
1039396206 8:37227425-37227447 CCCACCTCTCCCTCTCTCTGTGG + Intergenic
1039842750 8:41305510-41305532 CACATTTCTCTTTCTCTCTCTGG - Intronic
1040022700 8:42754968-42754990 CTCATTTCTCCTTCCCTCTGGGG + Intronic
1040522313 8:48188696-48188718 CACTCTTTTCCTTGTCTTTCTGG + Intergenic
1040658467 8:49541703-49541725 TACATTTCTTCTTGTCTCTTAGG + Intronic
1042495884 8:69454188-69454210 CACACTTGTCTCTGTCTATGAGG + Intergenic
1042838036 8:73095092-73095114 CTCACATCGCCTCGTCTCTGTGG - Intronic
1044510869 8:93076786-93076808 CGCACTTCTCCTTGTCTAGAAGG + Intergenic
1046455420 8:114453612-114453634 CACCCAGCTCCTAGTCTCTGTGG + Intergenic
1047167391 8:122454428-122454450 CCTACTTCTACTTGTTTCTGAGG + Intergenic
1047787463 8:128167824-128167846 CACTGTTCTACTTGTATCTGGGG + Intergenic
1048869574 8:138785944-138785966 CGCTGTTCACCTTGTCTCTGGGG - Intronic
1049162972 8:141109411-141109433 CACGCTTCTCACTGTCTCTAGGG + Intergenic
1049269115 8:141684777-141684799 CAAAGTTCGCCTTCTCTCTGCGG - Intergenic
1049866867 8:144944913-144944935 AACACTTCTCCCAGTCTTTGTGG + Intronic
1049935433 9:497372-497394 CCCAGTTCACCTTTTCTCTGAGG + Intronic
1051357541 9:16253595-16253617 CACACCTCTGCTGATCTCTGAGG + Intronic
1053022256 9:34702948-34702970 ATTACTTCTCCTTGTATCTGGGG - Intergenic
1055113135 9:72579358-72579380 CACACTTCTATATGTCCCTGGGG + Intronic
1055201326 9:73666169-73666191 CACCCTTGTTCTAGTCTCTGTGG - Intergenic
1058923774 9:109641740-109641762 CACACTACTCCTTGACATTGAGG + Intronic
1062534617 9:137015957-137015979 CCCACTTGTCCATCTCTCTGCGG + Exonic
1190385177 X:49878205-49878227 CACACTCCTCGTGGGCTCTGGGG + Intergenic
1190972423 X:55364207-55364229 CACAATATTCCTTGTGTCTGTGG + Intergenic
1192218184 X:69178401-69178423 CACAGTGCCCCTTGCCTCTGTGG - Intergenic
1194904430 X:99557354-99557376 CATAGATCTCCTTGTCCCTGGGG + Intergenic
1195208081 X:102624512-102624534 CACAGCTCTACATGTCTCTGGGG - Intergenic
1195744976 X:108107941-108107963 CACACATCCCCTTCTCCCTGAGG - Intronic
1196129330 X:112137396-112137418 CACAGTTCTGCATGGCTCTGGGG + Intergenic
1197117831 X:122853887-122853909 CACCTTTCTCCTTGCCTCTGGGG - Intergenic
1198839287 X:140839601-140839623 CACAGTTTTCCTGGTGTCTGAGG - Intergenic
1198935530 X:141899595-141899617 CACACTTGTTAATGTCTCTGAGG + Intergenic
1199391814 X:147288990-147289012 AACTATTCTCCTTGTCTTTGTGG + Intergenic
1199863513 X:151822696-151822718 CCCACCACTCCTTGTATCTGAGG - Intergenic
1199932631 X:152539710-152539732 CACACTTCCCCTTCTCTCTTGGG - Intergenic
1200247209 X:154532541-154532563 CACACTGCTCCTTCTCTGTAGGG + Intronic