ID: 1142673391

View in Genome Browser
Species Human (GRCh38)
Location 17:1498020-1498042
Sequence GAAGTGTGACGCCGGCGGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673388_1142673391 -8 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673387_1142673391 -7 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673384_1142673391 18 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18
1142673386_1142673391 -6 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673391 Original CRISPR GAAGTGTGACGCCGGCGGTA TGG Exonic
910748233 1:90597549-90597571 CAAGTGTGACCCCTGTGGTATGG + Intergenic
1090804830 11:130196446-130196468 GAAGTGAGTCCCCGGGGGTATGG + Exonic
1096649289 12:53054050-53054072 GAGGTGTGGGGCCGGCGGAAAGG - Intronic
1097021956 12:56026971-56026993 CAAGTGTGACGTCTGCGGCATGG + Exonic
1108698116 13:52920737-52920759 CATGTGTGACCCCGGAGGTAGGG + Intergenic
1142673391 17:1498020-1498042 GAAGTGTGACGCCGGCGGTATGG + Exonic
1148406863 17:47423678-47423700 GACGTGTCACCCCGGCGGTTGGG + Intronic
1149599534 17:57884654-57884676 GAAGAGTGAAGCCGGGGGAAGGG - Intronic
935781973 2:106516186-106516208 GAAGTGAGATGCTGGCGGTGGGG - Intergenic
1172098472 20:32472303-32472325 GAAGTCTGAGGCCTGCTGTAAGG - Intronic
1174316342 20:49705236-49705258 GAAGTGTGAAGCCAGAGGAAAGG + Intronic
1179049383 21:37875616-37875638 GAAGTGTGAGGCCAGCAATAAGG - Intronic
1182041740 22:27243396-27243418 GCAGTGTGACGACGGCTGCAGGG + Intergenic
1184503895 22:44889728-44889750 GAAGTGTGAAGACGGAGGGAGGG + Intronic
956026281 3:64986395-64986417 AAAGTGTGAGGGAGGCGGTAAGG - Intergenic
967922430 3:194623206-194623228 GAATTGTGAGGCCGGGGGTGGGG - Exonic
973758850 4:54099710-54099732 GAAGTGTGAGGCCTGCGGTTTGG - Intronic
1008652619 6:53578536-53578558 GAAGTTTGACGGTGGCGGGAGGG - Intronic
1022897055 7:34761106-34761128 GCAGTGTGAAGCAGGAGGTAAGG - Intronic
1049406783 8:142455154-142455176 GCAGTGTGGTGCCGGCGGCAGGG - Intronic