ID: 1142673392

View in Genome Browser
Species Human (GRCh38)
Location 17:1498021-1498043
Sequence AAGTGTGACGCCGGCGGTAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673386_1142673392 -5 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673388_1142673392 -7 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673387_1142673392 -6 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19
1142673384_1142673392 19 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673392 Original CRISPR AAGTGTGACGCCGGCGGTAT GGG Exonic
900236999 1:1597710-1597732 AAGTGTGTCGCCGTGGGAATGGG + Intergenic
908389188 1:63669876-63669898 AAGTGTTAGGCCGCCGGTGTGGG - Intergenic
923537188 1:234862443-234862465 AAATGTGACCCCGGAGGGATGGG + Intergenic
1078592586 11:12657557-12657579 AAGTGTGATGCTGGCGGTGCTGG + Intergenic
1090804831 11:130196447-130196469 AAGTGAGTCCCCGGGGGTATGGG + Exonic
1094619842 12:32069547-32069569 AAGTGTGAGGGTGGCTGTATGGG - Intergenic
1101936888 12:109065457-109065479 AAGTGTGAAGGCGGCTGTCTGGG + Intronic
1108698117 13:52920738-52920760 ATGTGTGACCCCGGAGGTAGGGG + Intergenic
1124048742 15:26175735-26175757 AAGTGTGAGGCAGGTGGTGTTGG - Intergenic
1142673392 17:1498021-1498043 AAGTGTGACGCCGGCGGTATGGG + Exonic
1154134344 18:11762515-11762537 CAGTGTGACGCCAGCTGCATGGG - Intronic
933724167 2:85417142-85417164 CAGTGTGACGCTGGCTGTACAGG - Intronic
1178402726 21:32300642-32300664 ACGTGTGACGCCCCCGGCATAGG - Intronic
1183594071 22:38799301-38799323 AAGTGAGATGCTGGAGGTATGGG - Intergenic
954661832 3:52230559-52230581 CAGTGTGACCCCAGGGGTATGGG + Intronic
956026280 3:64986394-64986416 AAGTGTGAGGGAGGCGGTAAGGG - Intergenic
958765951 3:98368039-98368061 AAGTGTGACACCAGCTGTAGTGG - Intergenic
1014802990 6:125797670-125797692 AAGTGTCACCCCTGCAGTATGGG + Intronic
1023630043 7:42154858-42154880 AAGTCTGACCCCGAGGGTATTGG - Intronic
1029101396 7:98133357-98133379 TAGTTTGACCACGGCGGTATAGG + Intronic