ID: 1142673393

View in Genome Browser
Species Human (GRCh38)
Location 17:1498029-1498051
Sequence CGCCGGCGGTATGGGAGTGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673384_1142673393 27 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673388_1142673393 1 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673386_1142673393 3 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25
1142673387_1142673393 2 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673393 Original CRISPR CGCCGGCGGTATGGGAGTGT CGG Exonic
901843244 1:11966491-11966513 GGGCGGCGGGATGGGAGTGGGGG + Intronic
1078140606 11:8689935-8689957 GGCCCGCAGTATGGCAGTGTTGG + Intronic
1079402721 11:20118745-20118767 GGCCGGCTGTGTGGGAGGGTGGG - Intronic
1081832095 11:46122132-46122154 CGCCGGCGGGAGGGGGGAGTTGG - Intergenic
1082807140 11:57458599-57458621 CGGCGGCGGGGAGGGAGTGTTGG - Intergenic
1091035042 11:132225225-132225247 GGGCTGCAGTATGGGAGTGTAGG + Intronic
1097107082 12:56632305-56632327 GGGCGGCGGGATGGGGGTGTGGG + Intronic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1118383692 14:65238182-65238204 CACCTGCGGGAAGGGAGTGTGGG - Intergenic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1142673393 17:1498029-1498051 CGCCGGCGGTATGGGAGTGTCGG + Exonic
1152321020 17:79608943-79608965 CGCCGGCGGGGTGGGGGCGTGGG - Intergenic
1166271816 19:41719071-41719093 CACCGGCTGTATGAGATTGTGGG + Intronic
1168904591 20:1392986-1393008 CGCCGCCGCCATGGGAGTGCAGG - Exonic
1180995744 22:19964427-19964449 CACCTGAGGTCTGGGAGTGTGGG + Intronic
953908841 3:46882063-46882085 CGGCGGCGGGATGTGAGTGCTGG - Intronic
968524364 4:1048453-1048475 GGCCCCCGGTATGGGAGAGTGGG - Intergenic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
981584343 4:146285069-146285091 AGACTGCAGTATGGGAGTGTAGG + Intronic
997366516 5:133328774-133328796 CGGAGGGGATATGGGAGTGTGGG + Intronic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
1006295624 6:33168842-33168864 AGCCGGGGGTATGGCAGGGTGGG - Intronic
1021983670 7:26079117-26079139 CGCGGGCGGTGTGGGCGCGTCGG - Intergenic
1030015767 7:105219154-105219176 CACTGGAGGTGTGGGAGTGTGGG - Intronic
1036169425 8:6468369-6468391 AGCCTGCGGTCTGGGTGTGTGGG - Intronic
1056273959 9:84974844-84974866 CGCCGGCTGTTTGGGAGTTAAGG + Intronic