ID: 1142673394

View in Genome Browser
Species Human (GRCh38)
Location 17:1498030-1498052
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673384_1142673394 28 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673386_1142673394 4 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673388_1142673394 2 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673387_1142673394 3 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type