ID: 1142673394

View in Genome Browser
Species Human (GRCh38)
Location 17:1498030-1498052
Sequence GCCGGCGGTATGGGAGTGTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673386_1142673394 4 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673387_1142673394 3 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673388_1142673394 2 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45
1142673384_1142673394 28 Left 1142673384 17:1497979-1498001 CCGTACGTCATGTGGCTGCTGTA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG 0: 1
1: 0
2: 1
3: 4
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673394 Original CRISPR GCCGGCGGTATGGGAGTGTC GGG Exonic
900284046 1:1890839-1890861 GGCGGCGGTGTGGGCGCGTCAGG - Exonic
901843245 1:11966492-11966514 GGCGGCGGGATGGGAGTGGGGGG + Intronic
902203526 1:14851369-14851391 GCTGGCAGTATGGGAGTGAGTGG - Intronic
904285525 1:29451142-29451164 GCCGGAGGAATGGGAGTGTGTGG + Intergenic
906663115 1:47596550-47596572 GCCTGGGGTATGGGATGGTCAGG + Intergenic
908688634 1:66752542-66752564 GCCGGAGGTCTGGGAGGCTCCGG + Exonic
1076076716 10:127539072-127539094 GCAGGAGATATGGGAATGTCAGG - Intergenic
1077476066 11:2791181-2791203 GCAGGCGGCAGGGGCGTGTCAGG + Intronic
1085273136 11:75282089-75282111 GATGGGTGTATGGGAGTGTCTGG - Intronic
1087194343 11:95290168-95290190 GAAGACAGTATGGGAGTGTCAGG + Intergenic
1089585246 11:119506374-119506396 GCAGGTGGAATGGGAGTGTGTGG + Intergenic
1102611779 12:114118704-114118726 GCCGCCGGAATGGGAGTGGGTGG + Intergenic
1108206453 13:48095014-48095036 GGAGGCGGTTTGGGAGTGGCGGG - Exonic
1132895759 16:2228652-2228674 GGCTGCGGTGTGGGAGGGTCCGG + Intronic
1135755253 16:25091932-25091954 GCAGGTGGTGTGGGAGTGGCTGG - Intergenic
1136536858 16:30904583-30904605 GCCGGCAGGATGGGACTGCCAGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143591449 17:7887785-7887807 GCCGGGGATGTGGGAGAGTCTGG + Intronic
1146946904 17:36879640-36879662 GCAGGGTGTATGGGAGTGTGCGG + Intergenic
1149563888 17:57628257-57628279 CCTGGAGGTCTGGGAGTGTCAGG + Intronic
1150216958 17:63476551-63476573 GCCGGGGGTAGGGGTGTGGCGGG - Intergenic
1151493493 17:74446119-74446141 GCTGGGGGTATGGTAGTGACAGG + Intronic
1152210446 17:79000451-79000473 GCGGGGGGTATGGGAGTGTCAGG - Intronic
1152579363 17:81159331-81159353 GCCGGCGGCCTGCGAGTGACCGG + Intronic
1152637622 17:81436576-81436598 GGCGGGGGTAGGGGAGTGGCAGG - Intronic
1155370719 18:25097535-25097557 ACTGGCAATATGGGAGTGTCTGG + Intronic
1161164536 19:2779097-2779119 GGGGGCGGTTTGGCAGTGTCTGG - Intronic
1161352820 19:3803397-3803419 GGCGGCGGGACGGGAGTGGCAGG - Intergenic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1163314971 19:16535540-16535562 GCCGGCGGGATGGGCGCGGCGGG + Exonic
1164947618 19:32309764-32309786 GCCGGCGACAGGGGAGTGGCAGG - Intergenic
1166060233 19:40321305-40321327 GCCGGAGGTACAGGAGGGTCGGG + Exonic
1174742206 20:53025983-53026005 GGCTGTGGTATGGCAGTGTCTGG + Intronic
1181395178 22:22616380-22616402 GCAGACTGGATGGGAGTGTCGGG - Intergenic
950330387 3:12151823-12151845 GCCAGGGGAATGGGAGAGTCAGG - Intronic
965087098 3:164113528-164113550 GCCTGCGGGATGGCAGCGTCAGG - Intergenic
968733337 4:2282174-2282196 GCAGCCGGTGCGGGAGTGTCTGG - Intronic
981584344 4:146285070-146285092 GACTGCAGTATGGGAGTGTAGGG + Intronic
991769417 5:70026603-70026625 CCCGGCAGTTTGGGAGAGTCGGG + Intronic
991848712 5:70902021-70902043 CCCGGCAGTTTGGGAGAGTCGGG + Intronic
999240536 5:150124901-150124923 GCCGGGGGTAGGGGAGTGGGGGG - Intronic
1004108779 6:12693683-12693705 CCTGGCATTATGGGAGTGTCAGG + Intergenic
1021983669 7:26079116-26079138 GCGGGCGGTGTGGGCGCGTCGGG - Intergenic
1034338812 7:150339753-150339775 GCCGGCTGTGTGGGTGTGTCTGG - Intronic
1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG + Intergenic
1041107012 8:54454028-54454050 GCGGGCGGGAGGGGAGTGTAAGG - Intergenic
1044890770 8:96832945-96832967 ACCGGTGGTATGGGAGGGCCAGG + Intronic
1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG + Intronic
1055397887 9:75892597-75892619 GCCGGCGGAGTGGGAGAGTACGG + Intronic
1056538927 9:87554818-87554840 ACCGGAGGTCTGAGAGTGTCAGG + Intronic
1059802457 9:117763982-117764004 GATGGGGGTAGGGGAGTGTCAGG - Intergenic