ID: 1142673398

View in Genome Browser
Species Human (GRCh38)
Location 17:1498042-1498064
Sequence GGAGTGTCGGGGCCAGCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142673386_1142673398 16 Left 1142673386 17:1498003-1498025 CCCCTCAGAGACAAGGAGAAGTG 0: 1
1: 0
2: 1
3: 24
4: 337
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188
1142673387_1142673398 15 Left 1142673387 17:1498004-1498026 CCCTCAGAGACAAGGAGAAGTGT 0: 1
1: 0
2: 0
3: 19
4: 245
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188
1142673388_1142673398 14 Left 1142673388 17:1498005-1498027 CCTCAGAGACAAGGAGAAGTGTG 0: 1
1: 0
2: 1
3: 30
4: 273
Right 1142673398 17:1498042-1498064 GGAGTGTCGGGGCCAGCACAGGG 0: 1
1: 0
2: 0
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142673398 Original CRISPR GGAGTGTCGGGGCCAGCACA GGG Exonic