ID: 1142676293

View in Genome Browser
Species Human (GRCh38)
Location 17:1515586-1515608
Sequence CTGGAATGGCAGAGGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142676285_1142676293 17 Left 1142676285 17:1515546-1515568 CCTAGGCACACGATGAGGAGTAC 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG 0: 1
1: 0
2: 3
3: 23
4: 288
1142676288_1142676293 -5 Left 1142676288 17:1515568-1515590 CCTGCAGCAGCTGGAGATCTGGA 0: 1
1: 1
2: 2
3: 24
4: 291
Right 1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG 0: 1
1: 0
2: 3
3: 23
4: 288
1142676283_1142676293 29 Left 1142676283 17:1515534-1515556 CCTAGCATGAGTCCTAGGCACAC 0: 1
1: 0
2: 1
3: 5
4: 90
Right 1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG 0: 1
1: 0
2: 3
3: 23
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142676293 Original CRISPR CTGGAATGGCAGAGGGTACA GGG Intronic
900804792 1:4760549-4760571 CTGGGATGGCCCAGGGTCCATGG + Intronic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
902282440 1:15384335-15384357 CTGGCATGGCACAGCGTAAAAGG - Intronic
902725020 1:18329748-18329770 TTGGATTGGGAGTGGGTACACGG - Intronic
903578593 1:24354351-24354373 CTGGAATGGAAGAGGGGATGTGG - Intronic
904583437 1:31564790-31564812 CTGGGCTGGCACAGGGTCCAGGG - Intergenic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
905484968 1:38289202-38289224 CTGGAGTAGCTGAGGCTACAGGG - Intergenic
905573309 1:39023748-39023770 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
906349138 1:45042259-45042281 CTGGTGTGGGAGAGGTTACATGG - Intronic
906517909 1:46450454-46450476 CTGGAAGGGCTGAGGGAACAGGG - Intergenic
908183217 1:61626537-61626559 CTGGAGTGGCAGAGGACAAATGG + Intergenic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
910358067 1:86383745-86383767 ACGGAATTTCAGAGGGTACATGG + Intronic
911058954 1:93731532-93731554 CTGGAAAGGAAGAAGGTACAAGG + Intronic
911131345 1:94391492-94391514 CTGGAATGGAAGAGGTCAAATGG - Intergenic
911200298 1:95037284-95037306 CTGGAATGGCTGAAGCAACATGG + Intronic
911336146 1:96583115-96583137 CAGCAATGGCAGATGGTACTTGG + Intergenic
911678319 1:100684403-100684425 ATGGGATGGCTGATGGTACATGG + Intergenic
915019864 1:152768998-152769020 ATGGAATAGCAGAGAGGACACGG + Intronic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917324874 1:173822301-173822323 ATGGAATGTCAGAGGAAACAAGG - Intronic
917499099 1:175569913-175569935 GTAGACTGGAAGAGGGTACATGG - Intronic
917585814 1:176425602-176425624 CTGTAATGGCAGAGGGTTTGTGG + Intergenic
919038265 1:192345421-192345443 CTTCAATGGAAGAGGGTAAATGG - Intronic
920126804 1:203700066-203700088 CAGCAATGGCCGAGAGTACATGG - Intronic
921377209 1:214486761-214486783 GGGGAATGGGAGAGGGTTCAGGG - Intronic
922291457 1:224212372-224212394 ATGGAATGGCAGAGTGCTCAAGG - Intergenic
922542874 1:226432613-226432635 CTGGAATTGCACAGGGATCATGG + Intergenic
924283081 1:242457789-242457811 GTGGAGTGACAGAGGGTAGAAGG - Intronic
1064701151 10:18023313-18023335 CAGGGATGTCAGAGGGTTCATGG + Intronic
1064767257 10:18687328-18687350 AGGGAATGGCAGATGGTATATGG - Intergenic
1065423048 10:25568333-25568355 CTTGAATGGCAGTGTTTACAAGG - Intronic
1067045627 10:42983671-42983693 CAGGAAGGGCAGATGGCACAGGG + Intergenic
1067451623 10:46385265-46385287 CTGGCCTGGCAGAGTGGACAGGG + Intronic
1067585616 10:47474491-47474513 CTGGCCTGGCAGAGTGGACAGGG - Intronic
1067755241 10:49000141-49000163 CTGCAGTGGCAGAGGGGCCATGG + Intergenic
1071880860 10:89897142-89897164 CTTGAATGGCAGAGGTCTCATGG + Intergenic
1073793224 10:106960815-106960837 CAGGAATGGGAGAGGGTCCAAGG + Intronic
1074233770 10:111564140-111564162 CTGGAAGGGCAGTGGGTCAAAGG + Intergenic
1075055624 10:119216381-119216403 CTGAAGTGGCAGAGGCCACAGGG + Intronic
1076094666 10:127721224-127721246 CTGGGGTGGCAGAGGCTACAGGG + Intergenic
1076608229 10:131703115-131703137 CTGGGATGACACAGGGTTCAGGG + Intergenic
1076789289 10:132768187-132768209 CTGGAATGCCACTGGGCACATGG - Intronic
1077463334 11:2721865-2721887 CTGCACTGGCAAAGGGGACAAGG - Intronic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1078101857 11:8334699-8334721 CAGGGAAGACAGAGGGTACAGGG - Intergenic
1079910139 11:26299659-26299681 CTAGAATGGCAGGGGGTGCAGGG + Intergenic
1080821431 11:35810494-35810516 CTGGAATGGGACAGGGTAGGGGG - Exonic
1080869907 11:36228194-36228216 CTGCCATGGAAGAGGGTCCAAGG - Intronic
1080899101 11:36470635-36470657 CTGGAGTGGGTGAGGGTACAAGG + Intergenic
1081996012 11:47364583-47364605 CTGGAATGGGAGTGGGTTCAAGG - Intronic
1085743048 11:79093288-79093310 CTGGACTGGCAGAGGGAGCTTGG + Intronic
1087610785 11:100432010-100432032 CTGGAATAGCAGAGGGCATGTGG - Intergenic
1087781535 11:102306053-102306075 CTGGCAGGGCAGAGACTACAAGG + Intergenic
1088096998 11:106113055-106113077 CAGAAAAGGCAGAGGGTAAATGG - Intergenic
1088552507 11:111027270-111027292 CTAGAATGGCAGAGGTCTCATGG - Intergenic
1088710286 11:112501777-112501799 ATGGAATGGAAGAGAGTGCAGGG - Intergenic
1091237830 11:134033519-134033541 CTGGGAGGGAAGAGGGTAGAGGG + Intergenic
1091995387 12:4988946-4988968 CTGGACTGGAAGGGGGTTCAAGG - Intergenic
1092259614 12:6946051-6946073 CTGGAAAGGCAGAGGGAATCAGG - Intergenic
1092709632 12:11322121-11322143 GTGGAATTGCAGATTGTACATGG + Intergenic
1095093268 12:38127268-38127290 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1096406345 12:51346729-51346751 CTGGCAGGGCTGAGGGTGCAAGG + Intergenic
1096871317 12:54594127-54594149 CAGGCTTGGCAGAGGGTACTGGG + Intergenic
1097896009 12:64825194-64825216 CTGGAAGGGTAGAGGGCAGACGG + Intronic
1099891046 12:88588581-88588603 CTGGAGTGGCACTGGGTACAAGG + Intergenic
1100617292 12:96240762-96240784 CTGAAATGGCAGAGGATCCAGGG + Intronic
1100761537 12:97812604-97812626 CTGGAATGCTAGAGGGAAGATGG + Intergenic
1101820942 12:108183937-108183959 AGGCAATGGCACAGGGTACATGG + Intronic
1101990450 12:109479907-109479929 CCTCAATGGCAGAGGGTCCATGG - Intronic
1102595547 12:113989723-113989745 CTGGAGTGAGAGAGGGTAGATGG + Intergenic
1103881390 12:124168455-124168477 GGGGAATGGCAGTGTGTACAGGG + Intronic
1105673023 13:22642016-22642038 CAGGAATGGTTGAGGGGACATGG - Intergenic
1106645468 13:31629566-31629588 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1108459857 13:50654386-50654408 GAGGAATGGCAGAAGGAACATGG + Intronic
1108713394 13:53056114-53056136 CTGGAAAGGCTGAAGGTGCAGGG + Intergenic
1113786835 13:113006499-113006521 CTGGAATGGCTAGGGGTCCAGGG - Intronic
1114775148 14:25473352-25473374 CTGGCATGCCAGAGGGGAGAGGG + Intergenic
1115722386 14:36177289-36177311 CTGGAAAGGCAGTGGGCAGATGG - Intergenic
1116360272 14:43986130-43986152 CTGTAAGGGGAGAGGGTATAAGG - Intergenic
1118600863 14:67470713-67470735 CTGGCATTGAAGAGGGGACAGGG + Exonic
1118706748 14:68487055-68487077 GTGAAAAGGCAGAGGGCACATGG + Intronic
1118730706 14:68664333-68664355 CTGTAAGGGCAGAGGTTAAAAGG - Intronic
1119986877 14:79148219-79148241 CTGGAAGCTCAGAGGGTTCATGG + Intronic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1123978711 15:25578718-25578740 GTGGAAGGGCAGAGGGCAGAGGG - Intergenic
1124138791 15:27059114-27059136 CCTGAATGGCAGAGGGCACCAGG - Intronic
1124338324 15:28873722-28873744 CTGGAATGGGAGGAGGAACATGG - Intergenic
1124633403 15:31350088-31350110 CTGGAATGGCCGAGGGTTAGGGG - Intronic
1126070399 15:44860925-44860947 CTGGGATGGCAGTGGGTATGTGG - Intergenic
1126087634 15:45024192-45024214 CTGGGATGGCAGTGGGTATGTGG + Intronic
1126142543 15:45449978-45450000 CTGGAATGGGAGAGGCTCGAGGG + Intergenic
1126932257 15:53667982-53668004 CTGGCATGGTGGATGGTACATGG - Intronic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1127817917 15:62628765-62628787 CTAGAGTGGAAGAAGGTACAGGG - Intronic
1128341369 15:66824726-66824748 CTGGGATGACAGAGGGGACTTGG - Intergenic
1130767559 15:86887208-86887230 ATGGAATGACAGAGGATAGATGG - Intronic
1130885186 15:88086927-88086949 CTGGAAGGGCAGAGCCTAGAAGG - Intronic
1132749674 16:1451800-1451822 CTGGCCAGGCACAGGGTACACGG - Intronic
1133119834 16:3599216-3599238 CTGAGATGGCAGAGGGCAGAGGG - Intronic
1133228626 16:4355416-4355438 TTGGAGTGGGAGAGGGAACAGGG - Intronic
1133303516 16:4796833-4796855 CTGGCATGGCACAGGGAACGCGG + Intergenic
1134191247 16:12122646-12122668 CTGGAGCGGCAGAGAGGACATGG + Intronic
1136026959 16:27474731-27474753 CTGGGGTGGCAGAGGGCGCACGG + Intronic
1137025982 16:35475069-35475091 CTTCAATGGCAGAAGGGACAAGG - Intergenic
1137031220 16:35526378-35526400 GTGGCCTGGCAGAGGGCACATGG + Intergenic
1140656297 16:77143533-77143555 CTGGCCTGGTTGAGGGTACAGGG - Intergenic
1142676293 17:1515586-1515608 CTGGAATGGCAGAGGGTACAGGG + Intronic
1143108794 17:4542314-4542336 CTGGCTTGGCTGTGGGTACATGG - Intronic
1143870387 17:9954018-9954040 CTGGAAGGACTGAGGGTCCAGGG + Intronic
1143929431 17:10406224-10406246 CAGAAATGGCAGAAGGTACTTGG + Intronic
1144063443 17:11603452-11603474 ATGGGATGGCAGAAGATACAAGG - Intronic
1144519171 17:15942961-15942983 TTGGAGTGGCAGAGGGCAAAGGG - Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1146514982 17:33482146-33482168 CAGTCATGGCAGAGGGTTCAAGG - Intronic
1148215041 17:45829775-45829797 CTGGAATGGCAGGGAGTAGAAGG + Intronic
1148858000 17:50589582-50589604 CTGGAATGGCAGATGAGACAGGG + Intronic
1149140544 17:53428245-53428267 CTGTGATGGGAGAGGGTGCAAGG - Intergenic
1149553506 17:57557140-57557162 AAGGCATGGCAGATGGTACACGG + Intronic
1149642262 17:58210830-58210852 CTGGAAACGCAGAGGGTTCCTGG - Intronic
1150724464 17:67640335-67640357 CTGGAAGGGGAGAGGGCTCAGGG - Intronic
1151550435 17:74819604-74819626 CTGGACTGGCAGAGGCTCCCTGG - Intronic
1152225163 17:79089511-79089533 CCGGAACAGCAGAGGGGACAGGG + Intronic
1152230876 17:79113470-79113492 CAGGTCTGGCAGAGGGTTCAGGG - Intronic
1152465673 17:80464720-80464742 CTGGCATGGCAGAAGGTAGTGGG + Intergenic
1152473379 17:80502783-80502805 CTGGAAGGGCAGAGCGTGCTGGG + Intergenic
1153389154 18:4534657-4534679 CTGTAATGGCAGTGGCCACAGGG - Intergenic
1155564625 18:27120412-27120434 GCAGAATGGCAGAGGGTCCAAGG - Intronic
1156313040 18:35942278-35942300 CTGGAAGGGAAGTGGGTAGAGGG + Intergenic
1156458959 18:37310665-37310687 CGGGAATGGCAGGGTGTGCAGGG - Intronic
1157957882 18:52119218-52119240 ATGGAACAGCAGAGGGTACTGGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159003507 18:62993033-62993055 TTGGAATGGCAGGCGGTACAGGG - Intergenic
1159849586 18:73511653-73511675 CTGGAATGGTATAGGATGCAGGG - Intergenic
1161531897 19:4794611-4794633 CTGAGATGGCCGAGGGCACAGGG + Exonic
1162327107 19:10005986-10006008 CTGGGTGGGCAGAGGGAACAAGG + Intronic
1162429315 19:10617832-10617854 CTAGAATGGCAGAGGGTGAGCGG - Intronic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163432010 19:17273881-17273903 CTGGGGAGGCAGAGAGTACAGGG - Intronic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1166556233 19:43701630-43701652 CTGGAAAGGCAAAGGCTCCAAGG + Intergenic
927173608 2:20390378-20390400 CTGGAGAGGCAGAGGTTGCAAGG - Intergenic
927419637 2:22916716-22916738 CTGGCAAGGCAGAGGGTAGCAGG + Intergenic
927427613 2:22998189-22998211 CTGAGATGGCAGAGAGTTCATGG + Intergenic
928975427 2:37082143-37082165 CCGGAAAGGCAGAGGTTGCAAGG - Intronic
929486415 2:42359333-42359355 AGGGATTGACAGAGGGTACAAGG + Intronic
929580464 2:43078957-43078979 CTGGAATGACGGAGGGCACTGGG + Intergenic
931206452 2:60150048-60150070 CAGGACTGGGAGAGGGTACCAGG + Intergenic
931284419 2:60820233-60820255 GCGGAAAGGCAGAGGGTCCACGG - Intergenic
931637646 2:64355161-64355183 CTGGACTGGGAGAGAGCACAAGG + Intergenic
931752175 2:65339272-65339294 CTGGAATGGAAGGGGGGGCAGGG + Intronic
931820385 2:65945755-65945777 CTGCTATGGCTGGGGGTACAAGG + Intergenic
932299535 2:70656427-70656449 CTGGAATGGAAGAGGGTGTCAGG - Intronic
932509300 2:72269394-72269416 CTGAAAAGGCAGAGAGTTCATGG + Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
935124269 2:100209185-100209207 CTGGAAGGGTAGAGGGTAGAAGG - Intergenic
935248705 2:101242254-101242276 GTGGAGTGACAGAGGGTAGAAGG - Intronic
935581599 2:104760565-104760587 AAGGAAAGGCTGAGGGTACAAGG - Intergenic
936251854 2:110873695-110873717 CTGCCATGGGAGAGGGTAAAAGG + Intronic
937108387 2:119341006-119341028 ATGGAATTGGGGAGGGTACATGG - Intronic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
938199935 2:129364451-129364473 CTGGTCTGGCATTGGGTACATGG - Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
942364476 2:175209129-175209151 TGGGAAGGGCAGGGGGTACATGG - Intergenic
944508333 2:200438774-200438796 CTGGAATAGCAGGGGGGAAAAGG + Intronic
945664630 2:212725455-212725477 CTCGAATGTCAGAAGGGACAGGG + Intergenic
948676877 2:239602024-239602046 CAGGAAGGCCAGAGGGTAAATGG - Intergenic
948799267 2:240424033-240424055 CCGGAGTGGCATTGGGTACAGGG - Intergenic
1168890187 20:1290355-1290377 CTGGAAGGGAAGAAGGAACAGGG - Intronic
1169747137 20:8953912-8953934 CTTGCATGGCAGAAGGGACAAGG + Intronic
1170579748 20:17689194-17689216 CAGGAATGGCAGAGGGGATGTGG + Intergenic
1170591874 20:17777546-17777568 CTGGAATGGAGGGAGGTACACGG - Intergenic
1170722513 20:18896185-18896207 GTGGGCAGGCAGAGGGTACATGG + Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1175112418 20:56657951-56657973 CTGGAGTGGCAGAGGGGAGCCGG + Intergenic
1175184376 20:57170111-57170133 GTGAAATTGCAGAGGGGACAAGG - Exonic
1175405303 20:58722244-58722266 CTGAGAGGGCAGAGGGTGCAGGG - Intergenic
1175420124 20:58826564-58826586 CTGGATTAGCAGAGGGGACCTGG + Intergenic
1176415167 21:6470406-6470428 ATGGAATGCCAAATGGTACATGG - Intergenic
1178898906 21:36583572-36583594 ATGGAATGGAAAAGGGTAGATGG - Intergenic
1179098257 21:38334914-38334936 GTGGTGTGGCAGAGGGGACAGGG - Intergenic
1179253529 21:39695350-39695372 CTGGACTGGCTGAAGGTAAAGGG + Intergenic
1179593852 21:42429197-42429219 CTAGAATGTCAGAGGGAGCATGG + Intronic
1179690667 21:43078739-43078761 ATGGAATGCCAAATGGTACATGG - Intergenic
1180755307 22:18156948-18156970 CTGGGTTGGGGGAGGGTACACGG + Intronic
1182166002 22:28174033-28174055 CTGAACTGGCAGAGAATACATGG - Intronic
1183960756 22:41410544-41410566 TGGGAGTGGCAGAGGGGACATGG + Intergenic
1184015706 22:41784316-41784338 CTGGCAGGGCACAGGGTAAAGGG - Intronic
1184435039 22:44467701-44467723 CTGGAGAGGCAGAGGTTGCAGGG - Intergenic
1184687981 22:46104975-46104997 CTGGAATGGCTGAGGTTGCGGGG - Intronic
950616561 3:14164730-14164752 CTGGAATGGCATCTGGCACATGG + Intronic
952268083 3:31806205-31806227 CTGGGAGGGCTGAGGGAACAAGG - Intronic
953348576 3:42197130-42197152 CTGGATTGCCAGAGGGGAGAGGG + Intronic
953970785 3:47345258-47345280 GTGGAATGGCAGAGCAGACAAGG - Exonic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
960319872 3:116221404-116221426 CTGGGATGGGAGAGTGGACAAGG - Intronic
961382735 3:126506186-126506208 CTGGAAGGCGAGAGGGGACAAGG - Intronic
961973554 3:130996045-130996067 CTGCAATCGAAGAGGGTAAAGGG + Exonic
963851589 3:150215661-150215683 CTTCAATGGAAGAGGGTACCTGG - Intergenic
964318173 3:155465860-155465882 CTGGGGTGGCAGTGGCTACAAGG + Intronic
965829373 3:172767059-172767081 CTGTAATGGCAGAGGCTTCTGGG + Intronic
970132421 4:12885987-12886009 TTGGAAAGGCAGAAGGTACTTGG + Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
970982514 4:22117253-22117275 CTGTAATAGCAGAGGGGAAAAGG + Intergenic
975428940 4:74265381-74265403 CAGAAATGGCAGAGGGTAAGTGG + Intronic
978380566 4:108124021-108124043 CTGGAGTAGCAGGGGCTACAGGG - Intronic
979588523 4:122449828-122449850 AAGTAATGGCAGAGGGTAAAGGG - Intergenic
980443004 4:132871566-132871588 CTGGAATGGCAGTGGCTATGGGG + Intergenic
981714168 4:147736602-147736624 CTGGATTGTCAGAGGGGAAAAGG - Intronic
982030381 4:151294670-151294692 CTGGAATGGTACCTGGTACATGG - Intronic
982333129 4:154204718-154204740 CTGGGATGGCAGAGGGTCTGTGG - Intergenic
982980092 4:162122137-162122159 CTTGAATGACACAGGGTATAGGG - Intronic
983747942 4:171224799-171224821 CTGGAGTGGCAGAGGCTACAAGG + Intergenic
984327405 4:178271543-178271565 CTGAAAGGGGAGAGGGTGCAGGG - Intergenic
984837856 4:184039322-184039344 CTGGCATAGCAGAAGGCACATGG + Intergenic
985073930 4:186193985-186194007 CTGGTCTGACAGAGGGGACAGGG - Intronic
985584954 5:726016-726038 CTGGAATGAAAGTGGGAACAGGG - Intronic
985598459 5:810330-810352 CTGGAATGAAAGTGGGAACAGGG - Intronic
985629178 5:1005861-1005883 CTGGAATGGCTGAGGGGACCAGG + Intergenic
985803420 5:2021275-2021297 CTGGAAAGGCAGAGGGCAGAGGG - Intergenic
986637481 5:9837323-9837345 CTAGAATAGCAGAGGCCACATGG + Intergenic
986765185 5:10919177-10919199 CAGGAATGGCAGCAGGTAAAGGG + Intergenic
986812828 5:11378107-11378129 CTGGAATTCCAGAGGGTAAGTGG + Intronic
987909397 5:24122280-24122302 CTGCAGTGGCAGAGGCTTCATGG - Intronic
988900976 5:35731910-35731932 CAGAAATCACAGAGGGTACAGGG + Intronic
991559222 5:67931618-67931640 CTGGAAAGGGAGTGTGTACATGG + Intergenic
995247195 5:109947833-109947855 CAGGAATGGCTGAGGGAATAGGG + Intergenic
995871509 5:116748260-116748282 CTGGAATGCCAGGGGCTTCAGGG + Intergenic
997238450 5:132289460-132289482 CTGGAATTGCAGAGACTAGATGG + Intronic
997439339 5:133898351-133898373 CTGGAATGGCAGCGGCTCCTGGG - Intergenic
998159272 5:139803898-139803920 CTTGGTTGGCAGAGGCTACAAGG + Intronic
999705586 5:154269801-154269823 CTGGACTGGCAGAGGGTAGGAGG + Intronic
999864270 5:155684006-155684028 CAAAAATGGCAGAGGGTAAAAGG - Intergenic
1001440398 5:171738326-171738348 CTGGAACGAGAGCGGGTACATGG + Intergenic
1001810825 5:174626937-174626959 CTGGAAGAGCAGAGGGTATTTGG + Intergenic
1002105220 5:176876665-176876687 ATGGCATGGCAGAGAGTAGAAGG + Intronic
1002490759 5:179575385-179575407 CTGGAATGGCAGGGGTTTCTTGG + Intronic
1002918536 6:1548482-1548504 CTGGAACGGCAGAGGGTGGTGGG - Intergenic
1005812472 6:29528139-29528161 CTGGAAAGGCAGAGGTCACCTGG - Intergenic
1007737489 6:43990719-43990741 CAGGAAAGGCAGAGAGTTCATGG - Intergenic
1009510295 6:64542585-64542607 TTGGAATGACAAAGGGGACAAGG - Intronic
1012032247 6:94086470-94086492 ATGGAATGGCTGTGGGCACAAGG - Intergenic
1012175736 6:96080650-96080672 TTGAAATGGAAGAAGGTACATGG - Intronic
1012252128 6:96991464-96991486 CTGTAATGGCAGAGGGGCTATGG + Intronic
1012442156 6:99270641-99270663 CCGGAAGGGCAGAGGGTTGAGGG - Intergenic
1012857923 6:104525406-104525428 CTGGAATGGAAGAGGAAACAGGG + Intergenic
1013262261 6:108456649-108456671 GTAGATTGGCAGAGGGTAGAGGG - Intronic
1014269072 6:119315575-119315597 ACCAAATGGCAGAGGGTACAGGG + Intronic
1014405564 6:121046499-121046521 GTGGAGTGACAGAGGGTAGAAGG - Intergenic
1015917882 6:138236548-138236570 CTGGGAAGGTAGAGGCTACAAGG - Intronic
1017054774 6:150426811-150426833 CTGGAATGGCAGTGGGGACATGG - Intergenic
1017700759 6:157067838-157067860 ATGTAATTGCAGAGTGTACATGG + Intronic
1021355683 7:19651191-19651213 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1022660410 7:32361585-32361607 GTGGAAGGGCAGAGGGCACAAGG - Intergenic
1023025887 7:36049302-36049324 GTGGAGAGGCAGAGGCTACATGG - Intergenic
1023213165 7:37830295-37830317 CTGCAATGGCAGAGGGTAGAAGG + Intronic
1023815538 7:43946839-43946861 GTGGCCTGGCAGAGGGTCCACGG + Intronic
1024588644 7:50862197-50862219 CTGGAAGAGTAGAGGGTCCACGG + Intergenic
1026023043 7:66725716-66725738 CTGGTATGACAGAGAGGACATGG + Intronic
1027185572 7:75968778-75968800 CTGGAACGTCAGAGTGGACAAGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029177953 7:98678274-98678296 CTGGCATTGCAGAGGGAAGAAGG + Intergenic
1030949246 7:115768431-115768453 CTGGAGTGGCAGGTGGTACTGGG + Intergenic
1031395287 7:121266299-121266321 CAGGAATGGCAGAAAGTACATGG + Exonic
1034684986 7:152962574-152962596 CTGACATGGAAGAAGGTACATGG - Intergenic
1035788802 8:2284949-2284971 TTGCAATGGGAGAGGGTATAAGG - Intergenic
1035804003 8:2436756-2436778 TTGCAATGGGAGAGGGTATAAGG + Intergenic
1036590901 8:10167129-10167151 CTGGCATGGGAGAGGGGACCTGG - Intronic
1038871841 8:31503778-31503800 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1040307865 8:46221546-46221568 CTGGAATGGGAGAGCCTTCAGGG - Intergenic
1041036790 8:53799800-53799822 CTCAGATGGCAGAGGGGACAGGG - Intronic
1041906294 8:63037295-63037317 ATGGAGTGGTACAGGGTACATGG + Intronic
1044691688 8:94886574-94886596 CTGGAATAGCTGAGACTACAGGG - Intronic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1046510860 8:115200675-115200697 CTGAAAAGGCAGAGGGTAAGAGG - Intergenic
1046857019 8:119044019-119044041 CAGGAATGCCTGAAGGTACAGGG + Intronic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048678625 8:136813271-136813293 GTGGTATGGCAGAGGATATAAGG + Intergenic
1049136549 8:140906656-140906678 CTGGGAAGGGAAAGGGTACAGGG + Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1050862585 9:10453752-10453774 TTGGAAGGGAAGAAGGTACATGG - Intronic
1051930976 9:22385079-22385101 CTGGAATGGAAGAGAATAGAAGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052443588 9:28530293-28530315 ATGGAATGGCAGATGGCACATGG - Intronic
1053141931 9:35688046-35688068 CTGGAGGGGCAGGGGGGACAGGG - Intronic
1053169822 9:35870437-35870459 ATGGAAGGAGAGAGGGTACAGGG + Exonic
1054782302 9:69176273-69176295 ATGAAATGACAGAGAGTACAAGG + Intronic
1055216218 9:73866133-73866155 CTGAAATGGCTAAGGGTACTGGG + Intergenic
1055460784 9:76518510-76518532 CAGGAAAGGTAGAGGGTATATGG - Intergenic
1055868948 9:80850956-80850978 CTGGAGAGACAGAGGTTACATGG + Intergenic
1056423335 9:86451786-86451808 CTCAAATGGCAGAAGGTAGAAGG + Intergenic
1056756128 9:89383064-89383086 GTGGAAGGGAAGAGGGGACAGGG + Intronic
1056798595 9:89675739-89675761 CTGCAAGGGCAGAGGGGACAGGG + Intergenic
1057875395 9:98749737-98749759 CAGGAATGGCAGACTGTATATGG + Intronic
1058355077 9:104074861-104074883 CTGGAATGGGAAAGGGAAAATGG + Intergenic
1059145187 9:111893694-111893716 AGGGAATGGCAGTGGGTATATGG - Intergenic
1059365238 9:113781664-113781686 CTGGAATGGGAGAGAGTAGGAGG - Intergenic
1059436898 9:114282507-114282529 CTGGAGTGCCAGGGGGTCCAGGG - Exonic
1061647458 9:132016729-132016751 CTGGAATGGCTGAGCTTGCATGG - Intronic
1061936507 9:133860638-133860660 CTGGAATGGCAGAGAGAGCCTGG - Intronic
1062402891 9:136380209-136380231 CTGCACTGGCAGGGGGAACAAGG - Intronic
1190567498 X:51745160-51745182 CCAGAATGGCAGAGGTTACTAGG - Exonic
1192865884 X:75131872-75131894 CTGTAATGGCAGAAGGGATATGG - Intronic
1193773826 X:85619804-85619826 CTGCAATGGCAGAGGGGCTATGG - Intergenic
1194568481 X:95522824-95522846 CTGGAGTGGCAGTGGTTATAGGG + Intergenic
1194839007 X:98715493-98715515 CTGTAGTGGCAGAAGGTAGAGGG + Intergenic
1196977756 X:121179190-121179212 GTGGAATGCCAGGGGGAACAAGG + Intergenic
1197096729 X:122604859-122604881 CTGGGGTGGCAGTGGCTACATGG + Intergenic
1197927383 X:131661298-131661320 CTGGAATGCCAGAGGCCACATGG + Intergenic
1199050628 X:143232657-143232679 CTGTAGTGGCAGTGGCTACAGGG + Intergenic
1199216267 X:145263230-145263252 CTGGGTTGGCAGTGGATACAGGG + Intergenic
1199439598 X:147853873-147853895 CTGGGGTGGCAGTGGCTACAGGG - Intergenic
1199767311 X:150950473-150950495 ATGGAAGGGCAGAGGATAGAGGG + Intergenic