ID: 1142680994

View in Genome Browser
Species Human (GRCh38)
Location 17:1548576-1548598
Sequence GTGGCTGGTGGGGCACGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142680994_1142681002 7 Left 1142680994 17:1548576-1548598 CCACGACGTGCCCCACCAGCCAC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1142681002 17:1548606-1548628 AGGACCACACAAGAGACCCCAGG 0: 1
1: 0
2: 2
3: 12
4: 182
1142680994_1142681004 20 Left 1142680994 17:1548576-1548598 CCACGACGTGCCCCACCAGCCAC 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1142681004 17:1548619-1548641 AGACCCCAGGCTACCTGCTGTGG 0: 1
1: 0
2: 4
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142680994 Original CRISPR GTGGCTGGTGGGGCACGTCG TGG (reversed) Intronic
900161399 1:1225618-1225640 GTGGCAGGTGGGGCACCTGGTGG + Intronic
901031068 1:6307160-6307182 GTCCCTGGTGGAGCACGGCGGGG + Intronic
905174039 1:36125229-36125251 GCGGCAGGAGGGGCGCGTCGGGG + Intergenic
905257091 1:36691766-36691788 GTGACTGGTGGGGCAGGTGCGGG + Intergenic
910449235 1:87329493-87329515 GGGGCTGGTGGGGACCGTAGAGG + Intronic
913528099 1:119712728-119712750 GTGGCTGCTGGGGCAGCTGGAGG + Intronic
914095375 1:144540165-144540187 GTGGCTCGTGGGTCCCCTCGCGG + Intergenic
914303151 1:146393731-146393753 GTGGCTCGTGGGTCCCCTCGCGG - Intergenic
915440257 1:155941484-155941506 GTGGTAGGTGGGGCAGGGCGAGG - Intergenic
921076225 1:211702212-211702234 GTGTCTGGAGGGGCAGGTGGAGG + Intergenic
922974348 1:229771270-229771292 ATGCCTGGTGGGGCAGGTCCAGG + Intergenic
924580061 1:245315747-245315769 GGGTGTGGTGGTGCACGTCGTGG + Intronic
1066278076 10:33888096-33888118 GGGGCTGGAGGAGCACGTGGTGG + Intergenic
1067088780 10:43256157-43256179 GTGGCTTGTGGGGCACAGTGTGG - Intronic
1068611472 10:59065136-59065158 GTGGCTGGAGGGGGATGTAGTGG - Intergenic
1071128819 10:82368583-82368605 GTGCCTGGTGAGGCAGTTCGGGG - Intronic
1072717641 10:97762277-97762299 GTGCCTGCTGGGGCAGGTCTGGG + Intergenic
1073438951 10:103541005-103541027 TTGGCTGGTAGGGCAGGTCAGGG + Intronic
1075046440 10:119149945-119149967 GTGGCTTATGGGGCCAGTCGGGG + Intronic
1075576418 10:123580866-123580888 GAGGCTGGAGGGGCAGGTAGGGG - Intergenic
1076778006 10:132708913-132708935 ATGGCTGGAGGGACACGTTGGGG - Intronic
1077195858 11:1279603-1279625 GTGGCTGGTGGGGCTGAGCGCGG - Intronic
1077222324 11:1423201-1423223 GTGCCTTGTGGGGTACGTGGTGG + Intronic
1080517797 11:33039814-33039836 GAGGCTGGCGGGGCCCGTCCGGG + Intronic
1082807984 11:57462015-57462037 GTGGCTGGTGGGCCAGATGGGGG + Intronic
1083365577 11:62139817-62139839 GAGGTGGGTGGGGCACGTCTGGG + Intronic
1083594335 11:63911841-63911863 GTGGTTGGTGGAGGACGTCAGGG + Exonic
1084088961 11:66867858-66867880 GTGGCTGCTGTGGCTCGCCGGGG - Intronic
1086064680 11:82732989-82733011 GCGGCGGGTGTGGCCCGTCGGGG - Exonic
1089197782 11:116704968-116704990 GTGGTGGGTGGCGCACCTCGTGG - Intergenic
1089369941 11:117948250-117948272 GTGGCTGGTGGGGCTGGGTGTGG + Intergenic
1089572422 11:119419389-119419411 GTGACTGGTGGGGCCCATGGAGG - Exonic
1090954753 11:131504166-131504188 GTGGCTGGTGGGGCTCAAAGGGG - Intronic
1092296984 12:7208611-7208633 GGGGCTGGTGGGGCAGGACTGGG + Exonic
1100962991 12:99984477-99984499 GTGGCTGTGGGGGCGCGTCGCGG - Intronic
1105439480 13:20403284-20403306 GTGGGTGGTGGGGCATGTAATGG + Intergenic
1113847848 13:113402776-113402798 GTGGCTGCTGGGCCATGTGGTGG - Intergenic
1114660169 14:24338783-24338805 GGGGCTGGTGGGGCAGCTGGTGG + Intronic
1120483502 14:85082307-85082329 GTGGGTGGTGGGGGAGGTCAGGG - Intergenic
1122891752 14:104735251-104735273 GTGCCTGGTGGGGCAGGTGGAGG - Intronic
1202927106 14_KI270724v1_random:36615-36637 GTGGCAGGTGGGGCCTGTGGAGG + Intergenic
1123994198 15:25706834-25706856 GAGGCTGGGCGGGCACGTCTGGG + Intronic
1125022932 15:35002826-35002848 GTGGGTGGTAGGGCACTTTGAGG + Intergenic
1125717460 15:41827464-41827486 GCGGCTGGTGTGGGAAGTCGGGG - Exonic
1125921504 15:43528215-43528237 AGGGCTGGTGAGGCAGGTCGTGG - Exonic
1129191654 15:73941222-73941244 CTGGCTGGTGGGGGACTTCTTGG - Intronic
1129514754 15:76150585-76150607 GTGGCTGGGAGGACACGTGGTGG - Intronic
1132357732 15:101185344-101185366 GAGCCTGGTGGGGCCCGTCAGGG - Intronic
1132669407 16:1096511-1096533 GTGGCTGGGCGGGCCCGGCGGGG + Intergenic
1135975895 16:27108950-27108972 GTGCCAGGAGGGGCACGTCCAGG - Intergenic
1136775490 16:32869649-32869671 GTGGCTTGTCTGGCACGTCTAGG + Intergenic
1136895126 16:33991863-33991885 GTGGCTTGTCTGGCACGTCTAGG - Intergenic
1137546151 16:49405109-49405131 GTGGCTGTGGGGACAGGTCGAGG - Intergenic
1141507502 16:84487598-84487620 GGGGCTGGTAGGGCACTTCCTGG + Intronic
1203077908 16_KI270728v1_random:1131758-1131780 GTGGCTTGTCTGGCACGTCTAGG + Intergenic
1142680994 17:1548576-1548598 GTGGCTGGTGGGGCACGTCGTGG - Intronic
1143542856 17:7579954-7579976 GTGGCTGGTGGTGCCTGTGGTGG - Exonic
1145102339 17:20087583-20087605 CTGGCTGGTGGGGCAGGGCCAGG + Intronic
1145758206 17:27408356-27408378 TGGGCAGGTGGGGCACGTCAGGG - Intergenic
1146968601 17:37054174-37054196 GTGGCTGGTGGGGGGCGTGTGGG + Intronic
1147578015 17:41613648-41613670 GTGGCTGGAGGGGCAGGATGGGG - Intronic
1147840621 17:43369008-43369030 GTGGCTGGGGCGGCACGGGGCGG + Intergenic
1148335972 17:46841643-46841665 GGGGCTGGTGGGGCGGGTAGGGG + Intronic
1150782485 17:68134472-68134494 GTGGATGGAGGGGCAGGGCGGGG + Intergenic
1151816563 17:76474157-76474179 AAGGCTGGTGGGTCATGTCGGGG + Intronic
1152818660 17:82424339-82424361 GTGGCTGCTGGAGCACGATGTGG - Intronic
1153673100 18:7431087-7431109 GTGAGTGGTGGAGCACGTAGAGG + Intergenic
1153987904 18:10369112-10369134 GTGGCTGGTGGTGCCCATTGGGG + Intergenic
1154210889 18:12377491-12377513 GGGGCTGATGGCGCACGTGGGGG + Intergenic
1154940837 18:21111559-21111581 GTGTCCGGTGGGGCAGGGCGAGG + Exonic
1159904618 18:74078335-74078357 AAGGCTGCTGGGGCAGGTCGGGG - Intronic
1160665799 19:327628-327650 GTGGGTGGAGGGGCACATCGGGG - Intronic
1161494438 19:4579882-4579904 GTGGGTGGTGGGGAACGGCTGGG - Intergenic
1161745323 19:6056013-6056035 GTGGGTGGGGGGGCAGGTGGCGG + Intronic
1162489494 19:10983990-10984012 GTGGCTGGTGGGGAAGGTACTGG + Intronic
1162791781 19:13066778-13066800 GTGGCTGGTGGAGCAGGGTGAGG + Intronic
1164623928 19:29714685-29714707 GTGGCTGGTGGGGCAGGGGCGGG - Intronic
1166748375 19:45152735-45152757 GTGGCTGCCGGGGGACGCCGGGG - Exonic
1167738670 19:51311687-51311709 GGGGCTGGGGGGGCGCGACGAGG - Intergenic
925008458 2:464633-464655 GAGGCTGGAGGGGCAGGTCTGGG + Intergenic
926076982 2:9950503-9950525 GTGGCTGGTGGGGCACAGGGAGG - Intergenic
927459395 2:23284952-23284974 GTGGCTGATGGGGCAAGGGGAGG - Intergenic
927489558 2:23511823-23511845 GTGGCTGGTGGGGGTGGTGGGGG + Intronic
927510281 2:23640078-23640100 GTAGCTGCTGGGGCATCTCGGGG - Intronic
927865103 2:26583160-26583182 CTGGTTGGTGGGGCAGGTGGGGG - Intronic
932864616 2:75328331-75328353 GTGGCTGCTGGAGCAGGTGGTGG + Intergenic
934652491 2:96100475-96100497 GTGGCTGGTGGGGACAGGCGGGG - Intergenic
935681171 2:105638463-105638485 GTGGCTGGAGGGGCCCCTCCAGG + Intergenic
936233423 2:110724252-110724274 GTGCCTGGTGGGGCCAGTTGAGG + Intergenic
937279321 2:120706463-120706485 GTGGCAGGTGGGGAACCTGGTGG - Intergenic
937290440 2:120778589-120778611 GTGGCTGGTGGGGTGAGACGGGG + Intronic
941768240 2:169322453-169322475 GTGGTTGGTGGTGCAGGTCTGGG + Intronic
944925122 2:204456453-204456475 GTGGCAGGTGGGGAAAGCCGAGG - Intergenic
945170485 2:206989844-206989866 GTGGGTGGTGGTGCCCGTCATGG + Intergenic
946758757 2:222972621-222972643 GTGGCTGCTGGGGCAGGTGAAGG + Intergenic
947359336 2:229331901-229331923 GTGACTGGTGGGGCAGGTAGGGG - Intergenic
947742346 2:232490466-232490488 GAGGCTGGCGGGGCTCGTCCTGG - Intergenic
947838981 2:233195441-233195463 GTGGCTGGTGAGGCTCTTCAGGG - Exonic
1172013120 20:31857937-31857959 GGGGCCGGTGGTGCAGGTCGTGG + Intronic
1175281042 20:57804243-57804265 GTGACTGGTGGCGAACGTGGAGG - Intergenic
1175366806 20:58461432-58461454 GCGGCTGGTGGGTCAGCTCGGGG - Exonic
1176257164 20:64158584-64158606 GGGACAGGTGGGGCAGGTCGGGG - Intronic
1178138070 21:29650785-29650807 GTGGCTGGTGGGGGAAGAGGAGG - Intronic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1182362015 22:29752268-29752290 GTGGCTGGGGAGGCAGGCCGAGG - Intronic
1182423091 22:30257939-30257961 GTGGCTGCTGGGGCAGGGAGTGG - Intergenic
1183237501 22:36630549-36630571 GTGGCTGGAGGGGAAGGTAGAGG + Intronic
1184729344 22:46364407-46364429 GGGGCTGGTGGGGCAAGTCAGGG - Intronic
1185038279 22:48490580-48490602 GCGGCTGGTGGGGTAAGTGGGGG + Intronic
949893653 3:8752965-8752987 CTGGCTGGTGGGTCACGCCGTGG + Exonic
950312755 3:11973572-11973594 GTGGATGTTGGGGCACTTTGTGG - Intergenic
953859821 3:46534070-46534092 GGGGCTGGTGGGGCAAGGGGAGG - Intronic
954304946 3:49720659-49720681 TGGGCTGGTGGGGCAGGTCAGGG + Exonic
960993264 3:123325295-123325317 GTGGCTGGTGGGGCAGCCTGTGG - Intronic
964359426 3:155878924-155878946 GTGGCTGCTGGTGCAAGTCCTGG + Intronic
965768372 3:172154903-172154925 GGTGCTGGTGGGACAAGTCGGGG + Intronic
967204056 3:187103432-187103454 GTGGCGGGTGGGGCACGGGGAGG - Intergenic
968526265 4:1059134-1059156 CTGCCTGCTGCGGCACGTCGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
968918726 4:3511485-3511507 GTGGCTGGTGGGGCGGGGGGTGG - Exonic
970518273 4:16857169-16857191 GTGGCAGCAGGGGCAGGTCGAGG + Intronic
972794478 4:42401312-42401334 GTGGCTGGTGGTGTATGGCGGGG - Exonic
985051372 4:185995580-185995602 GTGGCTGGTGGTGTAAGTCCTGG + Intergenic
985508187 5:296770-296792 ATGGGTGGGGGGGCCCGTCGAGG + Intronic
985551558 5:535764-535786 GTGCCTGGGGGAGCACGTTGGGG - Intergenic
985739851 5:1608901-1608923 ATGGGTGGGGGGGCCCGTCGAGG - Intergenic
985889185 5:2702312-2702334 CGGGCTGGTGGGGCTCGGCGGGG - Intergenic
986480425 5:8181047-8181069 GTGGGTGCTGGGGCACGACGGGG + Intergenic
997751669 5:136352282-136352304 ATGCCTGGTGGGGCAGGGCGGGG - Intronic
997983181 5:138482940-138482962 GTGGCTGGAAGGGCAGGTTGGGG + Intergenic
1000311078 5:160045435-160045457 GTGGAGGGTGGGGGATGTCGGGG - Intronic
1006671106 6:35730205-35730227 GTGGCTGGTGGGGAAGGGAGAGG + Intergenic
1006853936 6:37119715-37119737 GTGCAGGGTGAGGCACGTCGGGG + Intergenic
1007759817 6:44127367-44127389 TTGGCTGGTGGGGCCCGCGGCGG - Exonic
1007849213 6:44788086-44788108 GTGGCTGGTGTGGCACATCTCGG - Intergenic
1014890399 6:126837312-126837334 GTGGGTGGTGGGGCTAGTGGAGG - Intergenic
1017946571 6:159100917-159100939 GTGGCTGGTGGAGCAAATGGGGG + Intergenic
1018908377 6:168088155-168088177 GAAGCTGGTGGGGGACGTCAGGG + Intergenic
1020017048 7:4837215-4837237 CTGGCTGGTCGGGCAGGCCGCGG - Intronic
1022475653 7:30707824-30707846 GTGGCTGGTGGGGCTGGGTGGGG + Intronic
1023770250 7:43550531-43550553 GTGGCGGGTGGAGCGCGGCGTGG + Exonic
1023969238 7:44979056-44979078 GAGGCTGGTGGGGCAGGGCGGGG - Exonic
1023984652 7:45087790-45087812 GTGGCTGGTGGGGCATCACTGGG + Intronic
1024574722 7:50754424-50754446 GTGGCAGGTGGGGGAGGTCACGG + Intronic
1029701235 7:102248275-102248297 GTCGCTGGAGGGGCACGGAGGGG + Intronic
1032074614 7:128830483-128830505 GGGGCTGGCGGGGCTCGGCGAGG - Exonic
1032084006 7:128874269-128874291 GTGGGTGAGGGGGCACGGCGGGG - Intronic
1036662302 8:10716174-10716196 GTGGCTGCTGGGACAGGGCGGGG + Intergenic
1037588443 8:20294348-20294370 GTGGCTGGTGGGGCAGGTGTGGG - Intronic
1037977262 8:23222708-23222730 GTAGCTGGTGGGGCCTGTTGGGG + Intronic
1039334662 8:36575882-36575904 GACGCTGGTGGGGCACCTGGAGG - Intergenic
1041537488 8:58943254-58943276 GTGACTGCTGGGGCACGTGAAGG + Intronic
1049476140 8:142797770-142797792 AGTGCTGTTGGGGCACGTCGGGG + Intergenic
1049542387 8:143214519-143214541 GTGTGTGGTGGGGCACGCTGTGG - Intergenic
1049619016 8:143589445-143589467 TGGGCTGGTGGGCCAGGTCGGGG + Exonic
1052970097 9:34372136-34372158 GTGGCTTGTAGGGCGTGTCGTGG + Exonic
1053283339 9:36835577-36835599 CTGGGAGGTGGGGCACGCCGTGG + Exonic
1053294582 9:36903546-36903568 GAGGCTGCTGGGGCATGTCCAGG + Intronic
1058233558 9:102461504-102461526 GTTGCTGGTGGGGCAGGGGGTGG + Intergenic
1059102418 9:111483569-111483591 GGGGCTGGGGGGGCAGGGCGCGG + Intronic
1061897958 9:133658371-133658393 CTGGCTGGTGGGGCACTGTGGGG - Exonic
1062032294 9:134367199-134367221 GTGGCTGGTGGGGTCAGGCGGGG - Intronic
1062091197 9:134679587-134679609 GGGGCTGGTTGGGCACTGCGGGG + Intronic
1062285790 9:135771944-135771966 GTGGCTGCTGGGGCACCAGGTGG + Intronic
1062517516 9:136943891-136943913 CTGGGTGTCGGGGCACGTCGCGG + Exonic
1186601616 X:11043911-11043933 GTGGGTGGAGGGGCAAGTAGGGG - Intergenic
1186833745 X:13417280-13417302 GTGGGAGGTGGGGCTCGTGGGGG + Intergenic
1187670899 X:21664973-21664995 GTGGATGGTGGGGCACAGGGTGG + Intergenic
1189472212 X:41322973-41322995 CTGGCTGGTGGGGTAGGGCGTGG + Intergenic
1199879932 X:151965915-151965937 GAGGCAGGTGGGGCAGGTCGGGG - Intronic
1200104426 X:153704408-153704430 GTGGCTTGTCTGGCACGTCTAGG - Intronic