ID: 1142682376

View in Genome Browser
Species Human (GRCh38)
Location 17:1557756-1557778
Sequence CCCTCCTTTTACGAAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142682376_1142682385 21 Left 1142682376 17:1557756-1557778 CCCTGCCCTTCGTAAAAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1142682385 17:1557800-1557822 GCAGTCACCTATCGTGGCTAGGG 0: 1
1: 0
2: 0
3: 1
4: 43
1142682376_1142682384 20 Left 1142682376 17:1557756-1557778 CCCTGCCCTTCGTAAAAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1142682384 17:1557799-1557821 AGCAGTCACCTATCGTGGCTAGG 0: 1
1: 0
2: 0
3: 2
4: 55
1142682376_1142682382 15 Left 1142682376 17:1557756-1557778 CCCTGCCCTTCGTAAAAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1142682382 17:1557794-1557816 TTTCCAGCAGTCACCTATCGTGG 0: 1
1: 0
2: 0
3: 7
4: 48
1142682376_1142682381 -10 Left 1142682376 17:1557756-1557778 CCCTGCCCTTCGTAAAAGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1142682381 17:1557769-1557791 AAAAGGAGGGTTCTGTGTCTTGG 0: 1
1: 0
2: 2
3: 12
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142682376 Original CRISPR CCCTCCTTTTACGAAGGGCA GGG (reversed) Intronic
901779430 1:11583703-11583725 TCCTCCTTTTACACAGGGCTAGG + Intergenic
902088644 1:13884214-13884236 CCTTTCTTTTTTGAAGGGCACGG + Intergenic
902514734 1:16984001-16984023 CCCTCCTTTTTTCAAGGGTAGGG - Intergenic
906749136 1:48242969-48242991 CCTTCCTGTAAAGAAGGGCATGG + Intronic
913232113 1:116748624-116748646 CTCTCCTTTGACAAAGGGAAAGG + Intergenic
923479985 1:234374887-234374909 CCCCCCTTATACTAAGGACAGGG - Intronic
1070416424 10:76194294-76194316 CCTTCCATTTTCCAAGGGCATGG - Intronic
1073682404 10:105718485-105718507 CCCACATTTTATGAAAGGCATGG - Intergenic
1080075176 11:28139929-28139951 CCCTCCTTTTGCCTAGGCCAGGG + Intronic
1080387012 11:31816346-31816368 CCCTCCGATCACGAAGGGCACGG + Intronic
1083757412 11:64799175-64799197 GCCTCCTTTTGGGAAAGGCATGG + Intronic
1084278144 11:68066952-68066974 CCCTCCTGGTAAGAAAGGCAAGG + Intronic
1087815902 11:102658576-102658598 ACCTCCCTTTACCTAGGGCAAGG - Intergenic
1090725973 11:129527473-129527495 CCCTCCTTATCCTAAGGGAATGG + Intergenic
1100062839 12:90602648-90602670 CGCTCTTTTTCCGAAGGACATGG + Intergenic
1102643115 12:114383788-114383810 CCCTCCTTTTTACAAGGTCAAGG - Intronic
1106508809 13:30395246-30395268 CCCTCCATTTCCCAAGGGCTAGG + Intergenic
1107034375 13:35885024-35885046 CCCTCCTTCTACCAAGAGCCTGG - Intronic
1108133418 13:47328726-47328748 CCCTCCTTTGAAGAAGGAAAAGG - Intergenic
1109826394 13:67727764-67727786 CCCTCCCTTTTCCAAAGGCATGG + Intergenic
1113353158 13:109549449-109549471 CCCTCCATTTAAGAAGATCATGG - Intergenic
1113357173 13:109591896-109591918 CTCTCCTTTTCCCAATGGCAAGG + Intergenic
1122421178 14:101578600-101578622 GCCTCCTTTTTGGGAGGGCAGGG - Intergenic
1122582975 14:102783077-102783099 CCCTCCTTCCACCAAGGGCCAGG + Intronic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1139418337 16:66832175-66832197 CCCTCCTTTCAGGAAGAGAACGG + Intronic
1141554600 16:84828520-84828542 CCCTCCCTCTCCGAAGGGAAAGG - Intronic
1142679527 17:1538329-1538351 CCCTCTTTTGACCAAGGTCATGG + Intronic
1142682376 17:1557756-1557778 CCCTCCTTTTACGAAGGGCAGGG - Intronic
1143540404 17:7565085-7565107 CCCTCCTTGAAAGAAGGGCTGGG + Intronic
1143610045 17:8012899-8012921 ACCACCTTTTCTGAAGGGCAAGG + Intronic
1146106578 17:30043320-30043342 CCCTCCTTATAACAAGGACAAGG + Intronic
1150530359 17:65974720-65974742 TCCTCCTTACACGAAAGGCATGG - Intronic
1151317953 17:73335436-73335458 CACTCTTTCTACAAAGGGCAGGG + Exonic
1162393587 19:10403912-10403934 GTCCCCGTTTACGAAGGGCAGGG - Intronic
1165818372 19:38657825-38657847 GCCTTCTTTTACCAAGGCCAAGG + Intronic
929248393 2:39727118-39727140 CCCTCCATTTCCAAAGGTCAAGG + Intergenic
932858893 2:75267695-75267717 CCCTCCTTTTCCCAAGCACACGG + Intergenic
938948789 2:136238560-136238582 CACTACTCTTACGATGGGCAAGG + Intergenic
940004004 2:148994981-148995003 CTCTCCTTTTAGGCTGGGCACGG - Intronic
942382677 2:175408272-175408294 CCCTACTACTACTAAGGGCATGG + Intergenic
945236502 2:207636462-207636484 GGCTCCTTTAAAGAAGGGCAGGG + Intergenic
945987229 2:216364630-216364652 CCCTCCTTGGCCTAAGGGCAGGG + Intronic
946618818 2:221539074-221539096 CACTCCTTTTACCAAGTTCAAGG + Intronic
948309263 2:236972761-236972783 CCCTCCTGGTACGAAGGTCATGG + Intergenic
948534394 2:238635217-238635239 CCCTCCCTTTTCTAAGGGCAGGG + Intergenic
1175471359 20:59231736-59231758 TCCTTCTTTTACAAACGGCAAGG - Intronic
1185043731 22:48518489-48518511 CCCTCGTTTTCCTGAGGGCATGG - Intronic
949466644 3:4351375-4351397 GCCTCGTTTTACAAAGAGCAGGG + Intronic
950379525 3:12599656-12599678 CCCTCCCTTTACTAACTGCAGGG - Intronic
953508174 3:43507310-43507332 CCCTCCTGTAAAGAAGGGGAAGG - Intronic
954031147 3:47820804-47820826 CCCTCCTTTTTCACAGGGAAAGG + Intronic
956669670 3:71674841-71674863 TCCTCCTTTTTAGAAGGGCAAGG - Intergenic
966818164 3:183905848-183905870 CCCTACTTTTTCCCAGGGCAGGG - Intergenic
968001112 3:195207354-195207376 CCCTCTGTTGAAGAAGGGCAGGG - Intronic
969967017 4:11007396-11007418 CCGTCCTCTTACTAAGGTCATGG + Intergenic
970870238 4:20808672-20808694 TACTCCTTTAACAAAGGGCAAGG - Intronic
978106117 4:104903957-104903979 CTCTCCTTCTAACAAGGGCAAGG - Intergenic
982220916 4:153124469-153124491 CTCTCCAGTTACCAAGGGCATGG + Intergenic
997136186 5:131328998-131329020 CCCACCTTGTACAAGGGGCAGGG - Intronic
997676978 5:135720351-135720373 TCCTCCTTTCACAAAGGGCCTGG - Intergenic
1001574254 5:172751611-172751633 CTCTGCTTTTCCGCAGGGCAAGG - Intergenic
1001814825 5:174659749-174659771 CCCACCTTTCAGGAAGGGGAAGG - Intergenic
1009033693 6:58091378-58091400 CCTTCCCTTTAAGAAGGGCTTGG - Intergenic
1012427948 6:99134770-99134792 CCCTCCCTCCACCAAGGGCATGG - Intergenic
1023879145 7:44308693-44308715 CCCACCTTGTCCGGAGGGCAAGG + Intronic
1035671976 8:1425281-1425303 CCCCCCATTTACCATGGGCATGG - Intergenic
1037261771 8:17017791-17017813 CCCTCCTTTAATGAAGAGGAGGG - Intergenic
1038456479 8:27675033-27675055 GCCTCCTTCTAAGAAGAGCAGGG + Intronic
1046416457 8:113920952-113920974 TCCTCCATTCACAAAGGGCATGG - Intergenic
1048447613 8:134503679-134503701 CCCTCCTTTTCAAAAGGGGAGGG - Intronic
1055610919 9:78023147-78023169 CCTTCCTTTTCCAGAGGGCAGGG - Intronic
1055686509 9:78780588-78780610 CTCTCCTTCTACTATGGGCAAGG + Intergenic
1056294567 9:85179444-85179466 CCCTCCTTTTGGGAAAGGGATGG + Intergenic
1061753798 9:132798888-132798910 CCCTCCTGTCTCGAAGGGGAAGG + Intronic
1187349022 X:18494590-18494612 CCCTCATATTAGGAAGGGCTGGG + Intronic
1200077301 X:153557507-153557529 CACTCCTTTTCGGTAGGGCAGGG - Intronic
1202264183 Y:23000730-23000752 TCCTCCTTTTATGAAGGCCCAGG - Intronic
1202264203 Y:23000886-23000908 TCCTCCTTTTATGAAGGCCCAGG - Intronic
1202264223 Y:23001044-23001066 TCCTCCTTTTATGAAGGCCCAGG - Intronic
1202417175 Y:24634472-24634494 TCCTCCTTTTATGAAGGCCCAGG - Intronic
1202417195 Y:24634628-24634650 TCCTCCTTTTATGAAGGCCCAGG - Intronic
1202453572 Y:25035300-25035322 TCCTCCTTTTATGAAGGCCCAGG + Intronic
1202453592 Y:25035458-25035480 TCCTCCTTTTATGAAGGCCCAGG + Intronic
1202453612 Y:25035614-25035636 TCCTCCTTTTATGAAGGCCCAGG + Intronic