ID: 1142682732

View in Genome Browser
Species Human (GRCh38)
Location 17:1559998-1560020
Sequence CTGCTGTTCTTGAAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142682732 Original CRISPR CTGCTGTTCTTGAAGATAAA AGG (reversed) Intronic
901897291 1:12325030-12325052 CTTCTCTTTTTGAAGAGAAAGGG - Intronic
902265516 1:15260672-15260694 TTGCTGGTTTTGAAGATAAAGGG - Intronic
903598157 1:24512656-24512678 CTTCTGTTCTTTGAAATAAAAGG + Intronic
905751287 1:40466859-40466881 CTGATATACTTTAAGATAAAAGG + Intergenic
907694962 1:56715809-56715831 TTGCTGGTTTTGAAGATGAAGGG - Intergenic
908796635 1:67836390-67836412 CTGCTTGTCTTTAAAATAAAGGG + Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
909212962 1:72847690-72847712 CAGCTTTTCCTGAAGATACAAGG + Intergenic
910445328 1:87294169-87294191 CTACTCTTCATGAAGAAAAATGG + Intergenic
910489210 1:87749646-87749668 CTGCTGGTCTTGTAGGGAAATGG - Intergenic
910536783 1:88307189-88307211 CTGCTCTTCTTGAAGTCAAGAGG + Intergenic
911381477 1:97120395-97120417 CAGCTTTCCTTGAAGACAAAGGG + Intronic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914345278 1:146793792-146793814 CTGCTGTTCTGCAGGATCAAGGG - Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919341441 1:196312732-196312754 ATGGTGTTCTTTAAGATACAAGG + Intronic
919546575 1:198928993-198929015 TTGCTCTTCTTCAAGATATAAGG - Intergenic
919603954 1:199657102-199657124 ATGGTGTTCTTAAAGATAAAAGG - Intergenic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920200500 1:204257217-204257239 CTGCTGGTCCTGCAGACAAACGG + Intronic
920869177 1:209779333-209779355 CTCCTGTTCTTGAAGCTGTAAGG - Exonic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1064956233 10:20913860-20913882 CTCCAGTTTTTGAACATAAATGG - Intronic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1066521042 10:36219560-36219582 CTGCTGTTCTTGAAACATAAGGG + Intergenic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1068405849 10:56587157-56587179 CTGCTGATGTTGTAGATAACAGG - Intergenic
1068706572 10:60083089-60083111 CTTCTGTTCTTGGAGAGAGAAGG + Intronic
1073727740 10:106253833-106253855 GTGCTGTTGGGGAAGATAAAAGG - Intergenic
1075214982 10:120524473-120524495 CTGCTGTGTTTGCAGATAATTGG + Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076134546 10:128036397-128036419 CTGTTGTTACTGAAGATGAAAGG - Intronic
1076150303 10:128156927-128156949 CAGCTTTTCTTGAAGACACAAGG - Intergenic
1076337348 10:129716699-129716721 CAGCTGCTCTTGAACATCAAAGG - Intronic
1076374467 10:129973817-129973839 CTGCTGCTCTGGAAAAGAAAAGG + Intergenic
1076542589 10:131223541-131223563 CTGTTGGTTTTGAAGTTAAAAGG - Intronic
1077757754 11:5053489-5053511 ATGCTGCTCTTAAAGATAAGTGG - Intergenic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1080621715 11:33992338-33992360 TTGCAGTTCTAGAGGATAAATGG + Intergenic
1082672475 11:56052490-56052512 CTGCTGTCTTTGAAGATAGAAGG + Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1084868502 11:72080115-72080137 CTGCTATTGTTAACGATAAAAGG + Intronic
1085224452 11:74907060-74907082 GTGCTGTTCTGGAAGCCAAAAGG - Intronic
1086449841 11:86905086-86905108 CATCTGTTTTTGAAAATAAATGG - Intronic
1087144851 11:94801069-94801091 GTGCTGTTCTAGGAGAGAAATGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1089464112 11:118672985-118673007 CTGCTTTTCTGGAAGTTAAAGGG - Intronic
1089787049 11:120915210-120915232 CAGGTGTACTTGAAAATAAAGGG + Intronic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094772863 12:33685638-33685660 CTGCTGTCCTTTAATCTAAAAGG - Intergenic
1095122009 12:38430649-38430671 CTTCAGTTATTGAAGATACAGGG + Intergenic
1096471230 12:51877494-51877516 ATCTTCTTCTTGAAGATAAATGG + Intergenic
1097325759 12:58275202-58275224 CTGCTCTGCCTGAAGATTAAAGG - Intergenic
1097610568 12:61814830-61814852 CTGCTGGCTTTGAAGATGAAGGG + Intronic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098389689 12:69956479-69956501 CTACTTTCCATGAAGATAAATGG + Intronic
1098672190 12:73245913-73245935 CTGATGATCTTGGAGATAAAGGG - Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100667698 12:96772421-96772443 CTGCTGGCTTGGAAGATAAAGGG - Intronic
1101209481 12:102521864-102521886 TTGTTGTTCTTTAAGTTAAAGGG - Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1102105392 12:110317235-110317257 CTGTTGTTTTTGAATCTAAATGG - Intronic
1110146640 13:72199978-72200000 CTGCTGTTTTTGAAAAACAAAGG - Intergenic
1110308947 13:74023879-74023901 CTGGTGATCTTGAAGAAAAGGGG + Intronic
1111646687 13:91040371-91040393 CTGCTCATCTTGAAGAGAATGGG - Intergenic
1112803601 13:103138342-103138364 CTTCTGTTCTTGAAGTCACAAGG - Intergenic
1113772944 13:112923225-112923247 CTGAAGTTCATGGAGATAAAAGG - Intronic
1116614759 14:47120514-47120536 CTTCTGTTCCTGAAGAAAATAGG - Intronic
1116759965 14:48999790-48999812 CAGCTGTCATTGAAGATAGATGG + Intergenic
1117410188 14:55443392-55443414 TTGCTGGCTTTGAAGATAAATGG + Intronic
1118596447 14:67438943-67438965 CTACTGTTCTTGCACATATAAGG + Intergenic
1119251987 14:73164206-73164228 CTGCTGTTTATTGAGATAAATGG + Intronic
1120823489 14:88934353-88934375 ATGCTTTTCTTGGAGCTAAAGGG - Intergenic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1123177703 14:106437287-106437309 CAGCAATTCTTGAAGTTAAAGGG - Intergenic
1125006340 15:34821996-34822018 CCTCTGTTCTTGAAGATTCAAGG - Intergenic
1125671644 15:41477795-41477817 CTGGTATTCTTGAAGGGAAAAGG + Intronic
1126405305 15:48316990-48317012 CTGCCGGTTTTGAAGATAAAGGG + Intergenic
1126522959 15:49617969-49617991 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1127148897 15:56053723-56053745 CTGCAGCTCTAGATGATAAAAGG + Intergenic
1127272008 15:57409981-57410003 CTTCTGTTCTGGAAGATTAAAGG + Intronic
1127607028 15:60596692-60596714 CTGCTGTTTATGAGTATAAAGGG + Intronic
1128283621 15:66417773-66417795 CAGCTGTTCTTGTATATAAGGGG + Intronic
1128383102 15:67127641-67127663 CTGGAGTTCCTGAAGATGAAGGG + Intronic
1130192595 15:81750751-81750773 CTGCTGTTTTTGCAGAACAAGGG - Intergenic
1130926903 15:88392321-88392343 CTGCTGGTCTAGAAGATACTGGG - Intergenic
1131691167 15:94829494-94829516 CTGGTGTTATAGAAGATATAGGG - Intergenic
1133311751 16:4852491-4852513 CTGCTGGTGATGAAAATAAAGGG + Exonic
1133456836 16:5949683-5949705 CTGCTGTTCTACAAAACAAATGG - Intergenic
1133657850 16:7883703-7883725 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1137295131 16:47085033-47085055 CTGCTGTCTTAGAGGATAAAAGG + Intronic
1137989379 16:53137787-53137809 TTTATGTTCTTGAAGATAAATGG + Intronic
1138049062 16:53756751-53756773 CTGCTATTCTTCAAATTAAAAGG - Intronic
1138166784 16:54809469-54809491 CTGCCTTCCTTGAAGCTAAATGG + Intergenic
1139988714 16:70921500-70921522 CTGCTGTTCTGCAGGATCAAGGG + Intronic
1141149340 16:81553229-81553251 CTGCTTTTCTGGAAGATGAAGGG + Intronic
1141804205 16:86332020-86332042 CTGCTGACTTTGAAGATTAAGGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143070342 17:4286738-4286760 TTACTCTTCTTTAAGATAAAAGG + Intronic
1143361904 17:6377899-6377921 AGGCAGTTCTTCAAGATAAAGGG - Intergenic
1143763784 17:9124153-9124175 CTGCTGATTTTTAAGAAAAATGG - Intronic
1145110695 17:20158722-20158744 CTGCAGTCCTTGCAGATGAATGG + Intronic
1146448284 17:32950962-32950984 CTTCTATTCCTTAAGATAAAAGG - Intergenic
1146636972 17:34513734-34513756 CTACTGTTCTTGTGTATAAATGG + Intergenic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1149092564 17:52801714-52801736 CTGCTGATGTTGCAGAGAAAGGG - Intergenic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1152429149 17:80237825-80237847 CTGCTGTTTGTGGAAATAAAAGG + Intronic
1153808406 18:8730942-8730964 CTGCTTTTCTTAAAAATAATTGG + Intronic
1154248888 18:12726191-12726213 CTGCTGGCTTTGAAGATAGAAGG - Intergenic
1155424029 18:25687283-25687305 ATGCTATTTTTGAAAATAAAAGG + Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155841679 18:30652643-30652665 CAGCTATGCTTCAAGATAAAGGG + Intergenic
1156387628 18:36620244-36620266 CTCCTGTTTTTGAACATGAAAGG + Intronic
1156902658 18:42319498-42319520 CTGCTGATCTAGAAGAGAAGAGG + Intergenic
1157005771 18:43582227-43582249 CTCCTGTTCTGAAAGATAACAGG + Intergenic
1157124487 18:44943172-44943194 CTCCTGTTCATGAGCATAAATGG + Intronic
1157922554 18:51728218-51728240 CTGCTGGTCTGGAAGAGAGAAGG + Intergenic
1157928685 18:51794735-51794757 TTAATGTTCTTGAAAATAAATGG - Intergenic
1158232265 18:55270389-55270411 CTGATCTTCTTGAAACTAAATGG + Intronic
1159062183 18:63527603-63527625 CTGCTGTAATTGAAGTTTAAGGG + Intergenic
1159687693 18:71443862-71443884 TTGTGGTTTTTGAAGATAAAAGG - Intergenic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1164398221 19:27884762-27884784 GTGCTGTTACTGAGGATAAAGGG - Intergenic
1164453351 19:28385839-28385861 CTGCTGTTCTTGAATAAACATGG - Intergenic
1166009377 19:39930318-39930340 TTGCATTTATTGAAGATAAATGG + Intronic
926510449 2:13770710-13770732 CTTCTGTTCTGGAAGAGGAAAGG - Intergenic
926559035 2:14394947-14394969 CTGCTGATGTTGAAGACAGAGGG + Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
928131780 2:28656896-28656918 CTGCTGTTCTTACAGGGAAATGG + Intergenic
929821259 2:45275731-45275753 CTTCTGTTCTTGAAGATTTCTGG + Intergenic
929827192 2:45318109-45318131 TTGCTGGTTTTGAAGATGAAAGG + Intergenic
929846222 2:45531128-45531150 CTGCTTTCCTTGAAAAGAAAAGG + Intronic
930494352 2:52121430-52121452 CTGCTGTTCTTTAACCTATAAGG + Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934552125 2:95269003-95269025 CTGCTGATCTTGGAGAGAGAGGG + Intergenic
934651558 2:96094183-96094205 CTGCTCTTGTTGAAAATCAATGG - Intergenic
936065258 2:109326694-109326716 TATCTGTTCTTGAAGATAGATGG + Intronic
936434249 2:112489915-112489937 CAGATTTTCTTGAAAATAAAAGG - Intronic
936804800 2:116317942-116317964 CTGCTGTGGTAGCAGATAAATGG + Intergenic
937468685 2:122156747-122156769 CTTCTCTTTTTGAAGATAATTGG + Intergenic
938109404 2:128553900-128553922 CTGCTGGTGTTGAAAACAAATGG + Intergenic
938190997 2:129280604-129280626 CTGCTGTTGTTGAAGTTGAAGGG + Intergenic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
939278229 2:140029221-140029243 CTGCTTTTCTTTAAAATAACTGG - Intergenic
940031152 2:149262838-149262860 CAGCTGTATTTGGAGATAAAAGG + Intergenic
942108996 2:172661401-172661423 CTGCTGTTCTTGAGGTTATTTGG + Intergenic
943599994 2:189905533-189905555 CTGCAGACCTTGAAGACAAAAGG - Intronic
944347185 2:198683650-198683672 CTGCTGTTATAGATCATAAATGG - Intergenic
944374295 2:199023235-199023257 TTGCTGTTTTTGAACTTAAATGG + Intergenic
944383466 2:199138479-199138501 TTGCTGTTCTTTATGATAATGGG - Intergenic
945096602 2:206225572-206225594 CTGTTGCACTTGGAGATAAAGGG + Intergenic
945115440 2:206403785-206403807 CCCCTGTTATTGAACATAAAAGG - Intergenic
945668762 2:212776379-212776401 CTGCTGTTCATTAACATGAAAGG + Intergenic
948070066 2:235113935-235113957 CTGCTGGTCTTGGAGATGAGGGG - Intergenic
1169844460 20:9974555-9974577 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
1174746462 20:53068078-53068100 CTGGTGTTCTTAAAAATCAAAGG - Intronic
1174879820 20:54267060-54267082 CTGCTGCGCTTGAAGACACAAGG + Intergenic
1177684899 21:24423129-24423151 CTGCTATTCTTGAACCTGAAAGG - Intergenic
1179648120 21:42788008-42788030 CAGCTGTTCTTTATAATAAAGGG - Intergenic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1180645388 22:17334382-17334404 CTCCTGTTGTTGATGACAAACGG - Intergenic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
949843301 3:8343546-8343568 CTGGTGTTCTGGAAGAAAAATGG + Intergenic
949852252 3:8431023-8431045 TTTCTGGTCTTGAAGATGAAAGG + Intergenic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
952352710 3:32555977-32555999 CTGCTGTTCTTACAGGTAAAGGG + Intronic
954739354 3:52735237-52735259 CTGATGTTTTTGAAGATAACTGG - Intronic
955605040 3:60692527-60692549 TTGCTGATATTGAAGATGAAAGG + Intronic
955701949 3:61690367-61690389 CTGCTTTTCTCCAGGATAAATGG + Intronic
956175540 3:66470105-66470127 CAGCTTTTCTTGAAAATAATCGG + Intronic
956906653 3:73772804-73772826 CTGATGTCTCTGAAGATAAAAGG + Intergenic
957717782 3:83953409-83953431 CTATTGTTCTTAAACATAAAAGG - Intergenic
958056212 3:88415728-88415750 CTGTGGTTCTTGAAGTTAGATGG - Intergenic
958593802 3:96195283-96195305 CTGCTAGCCTTGAAGATGAATGG - Intergenic
958969385 3:100594646-100594668 CTGATGTTCTGCAACATAAAGGG + Intergenic
959318914 3:104846130-104846152 CTGCTTTTTTTATAGATAAAGGG - Intergenic
959695309 3:109243477-109243499 CTGGTCTTCTTCAAGATTAATGG + Intergenic
959980217 3:112507698-112507720 ATGCTGGCTTTGAAGATAAAGGG - Intergenic
960830130 3:121837331-121837353 CTGATGTTCATGCAGATAAGGGG + Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
962679723 3:137785679-137785701 TGGCTGTTCTGGAAGATCAAAGG - Intergenic
962991593 3:140582409-140582431 GTTCTGTTCTTGAAAATAATGGG + Intergenic
963438555 3:145306076-145306098 TTGCTGGTTTTGAAGATACAGGG - Intergenic
963704202 3:148665509-148665531 CTGCTGTTTTCCAAGAGAAATGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965436949 3:168664057-168664079 CTGCTGTTCTTGATGAGACTTGG + Intergenic
967900915 3:194451488-194451510 CTGCTGTTGCTGAATATAATGGG - Intronic
970720267 4:18980040-18980062 CTACAGTTCTTGAAAATCAAAGG - Intergenic
971183906 4:24355397-24355419 CTCCTCTTCTTGACAATAAAAGG - Intergenic
971400135 4:26268545-26268567 GTGCTTTTATTGAAGAGAAAAGG - Intronic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972687609 4:41366181-41366203 CTGATGTTGCTGATGATAAAAGG + Intronic
973897566 4:55430090-55430112 CTGGGGTTCTTGAATAAAAATGG - Exonic
975064460 4:70043088-70043110 CTGTTGTTTTCGTAGATAAATGG - Intergenic
975355717 4:73401099-73401121 CTTCTTCTCTTAAAGATAAAGGG - Intronic
975740774 4:77426730-77426752 GTGCTGTTCATCAAGATAATGGG - Intronic
975887485 4:78982679-78982701 CTGCTGACCTTGAAGATGAAGGG + Intergenic
976311801 4:83620542-83620564 CTGGTGTTCTTGTAAAAAAAAGG - Intergenic
976944267 4:90745231-90745253 TTGCTGGTTTTGAAGATAGACGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
978226780 4:106344593-106344615 CTGCTCTAATTGAAAATAAATGG - Intronic
978295272 4:107197559-107197581 TTTTTTTTCTTGAAGATAAATGG - Intronic
978748998 4:112225952-112225974 AAGATGTTCTTAAAGATAAAAGG - Intergenic
979200435 4:117971431-117971453 CTGCTGCTGTTTAAGGTAAAGGG - Intergenic
979580702 4:122355952-122355974 CTGTGGTTCTTGAACATGAATGG - Exonic
979817069 4:125121825-125121847 CAGCTGTTCTGGAAAAAAAAAGG + Intergenic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
983073356 4:163295189-163295211 CCAGTGTTCTGGAAGATAAATGG + Intergenic
983738920 4:171102900-171102922 CTGTTGTCCTTGAATCTAAAGGG - Intergenic
984029102 4:174581366-174581388 CTCCTATTCTTGTATATAAAGGG + Intergenic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG + Intergenic
987298560 5:16576260-16576282 ATCTTGTTTTTGAAGATAAATGG - Intronic
987520885 5:18981876-18981898 CTGGTGATGTTGAAGAGAAAGGG - Intergenic
991121014 5:63013651-63013673 CTTCTGTTCTTGTAGATCATAGG + Intergenic
991556337 5:67898728-67898750 CTGCTGTTATTAAACTTAAAAGG - Intergenic
992077702 5:73206395-73206417 CTGCTGGCTTTGAAGATGAAGGG - Intergenic
993101834 5:83550262-83550284 CTCCTGTTCATGAACATAGAAGG - Intronic
993544411 5:89193593-89193615 CTGCCTTTTTTGAAGATCAATGG + Intergenic
993838190 5:92841542-92841564 CTATTGTTTTGGAAGATAAAGGG - Intergenic
994189674 5:96855788-96855810 CTGTTGGTCTTGTAGGTAAAAGG + Intronic
995541817 5:113193096-113193118 CTGCTGGCCTTGAATATGAAGGG - Intronic
996140130 5:119896963-119896985 CTGCTGTCTTTGAAGACAGAAGG - Intergenic
996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG + Intronic
996588369 5:125117532-125117554 CTACTGTTCTTGAAGATCATTGG - Intergenic
997177238 5:131792135-131792157 CTGCTGTTCATGATGATAACTGG + Intronic
997487279 5:134242060-134242082 TTGGTGTTGTTGAAGATAATGGG + Intergenic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
999667074 5:153923994-153924016 CTGCTTGTCTTTAAGTTAAAAGG - Intergenic
1000794831 5:165652080-165652102 CTGCTTTTCTTGCATAGAAAAGG + Intergenic
1001805268 5:174579344-174579366 CTGCTGGTTTTGAAGATTAGAGG + Intergenic
1003342110 6:5231481-5231503 CTTCACTTCTTGAAGTTAAAGGG + Intronic
1003646072 6:7913678-7913700 CTGCTGGTTTGGAAGATGAAGGG + Intronic
1003998200 6:11565202-11565224 CTGAAATTCTTAAAGATAAAAGG + Intronic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1007013364 6:38438980-38439002 TTGCTGTTCTTGAACACACAAGG - Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007814583 6:44512141-44512163 CTACTGGTTTTGAGGATAAATGG + Intergenic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008386605 6:50898179-50898201 CTGCTGTTCTAGGAGCTGAAAGG + Intergenic
1008525425 6:52402902-52402924 CTGCTGTTGTTGTAGAGACAGGG - Intronic
1010947811 6:81998800-81998822 CAGCTATACATGAAGATAAATGG + Intergenic
1011117437 6:83909076-83909098 CTGCTGTTCTGAAAGGTAAGTGG + Exonic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1012609657 6:101200544-101200566 CTGCTGGTCTATTAGATAAATGG + Intergenic
1014113184 6:117644227-117644249 TTGCTCTTCATGAATATAAAAGG - Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1015156660 6:130103888-130103910 CTGATGTTCTAGAAAATACATGG - Intronic
1015439479 6:133231819-133231841 CTTCTGTTCTTGTAGACAGAGGG + Intergenic
1015855945 6:137624803-137624825 CTTCTCTGCTTGAAGAGAAAGGG - Intergenic
1017036522 6:150272122-150272144 CAGCTGTGCCTGTAGATAAAGGG + Intergenic
1017657095 6:156640329-156640351 CTGTTGTTTTAGAAAATAAATGG - Intergenic
1017657442 6:156643528-156643550 AGCCTCTTCTTGAAGATAAACGG + Intergenic
1017809380 6:157973926-157973948 GTGCTGATGTTGAAGAGAAATGG + Intergenic
1021167813 7:17362017-17362039 ATGATGGCCTTGAAGATAAAGGG + Intergenic
1021285291 7:18773503-18773525 CTGCAGTTGCTGAAGGTAAATGG + Intronic
1021962099 7:25883537-25883559 CTGTTTTTCTTCAAGATTAAGGG - Intergenic
1022184859 7:27957176-27957198 CTGCTGTTCCTGAAGGTCACAGG - Intronic
1023503690 7:40877920-40877942 CTACTGTTCTGTCAGATAAATGG + Intergenic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024689202 7:51780865-51780887 CAGCTGTCCCTGAAGACAAAAGG + Intergenic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1026613577 7:71882210-71882232 CTGCTGGCTTTGAAGATAGAGGG - Intronic
1027435257 7:78157862-78157884 CAGCTTTTCATGAAGAAAAAGGG + Intronic
1028011160 7:85646769-85646791 CTCCTATTCATGAAGATAGACGG - Intergenic
1029387973 7:100256294-100256316 CTGCTGTTGATGAAGATGACAGG - Intronic
1029419291 7:100464140-100464162 CTGCTGTGCTTGAAGCTCACAGG - Exonic
1031550984 7:123111244-123111266 TTGCTGGCTTTGAAGATAAAAGG - Intergenic
1032100755 7:128974924-128974946 CTGCTGTTCTAGGAGCTGAAAGG + Exonic
1033068567 7:138180255-138180277 CTGCTGTCTTTGAAGATGGAAGG + Intergenic
1036739892 8:11350465-11350487 CTGCTGTTAATGCAGATAAGTGG + Intergenic
1037085622 8:14845948-14845970 ATGCATTTCTTGATGATAAACGG + Intronic
1037174521 8:15931122-15931144 CTGCTCTTCTGGATGATGAAAGG + Intergenic
1037343146 8:17869380-17869402 ATGTTGATCTTGAATATAAATGG + Intronic
1039262031 8:35782237-35782259 TTACTGCTCTTGAGGATAAATGG + Intronic
1043127793 8:76421583-76421605 CTGCTGTTCCTTCAGATGAAGGG - Intergenic
1043637350 8:82402901-82402923 TTGCTTTTATTGAAGATAGAAGG + Intergenic
1043650868 8:82589862-82589884 CTAGTGTTCTAGAAGATACATGG - Intergenic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1044875544 8:96662439-96662461 GTCCAGTTCTTAAAGATAAATGG + Intronic
1044941622 8:97349398-97349420 CTGCTGTTCTGGCAGGTAGAAGG - Intergenic
1048213156 8:132473881-132473903 CAGCTGCTCTGGAACATAAAGGG - Intronic
1048661939 8:136614521-136614543 CAGCTGTGCTTGTAGCTAAATGG + Intergenic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1053383535 9:37668462-37668484 CAGCTATTTTTAAAGATAAAAGG - Exonic
1053598337 9:39585755-39585777 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1053856370 9:42342764-42342786 CTGCTGATGTTCAGGATAAAGGG - Intergenic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1056570421 9:87809935-87809957 CTGCTGCTTTTGAAAATGAAGGG + Intergenic
1057079829 9:92164947-92164969 AAGTTGTTCCTGAAGATAAAAGG + Intergenic
1057894441 9:98896265-98896287 CTCCTGTTCTTTAAAATAATTGG - Intergenic
1057958172 9:99428858-99428880 CTGCTGGCTTTGAAGATAGAAGG + Intergenic
1059397582 9:114047938-114047960 CTGCTGTTGTAGAAGAGAAGTGG + Exonic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186792484 X:13012477-13012499 CTGCTGGCTTTGAAGATAGAGGG + Intergenic
1189706964 X:43768586-43768608 GTGCTCTTCTTGAAAATAATGGG + Intronic
1191157405 X:57288679-57288701 CTGATGTCCTTTAAGAAAAATGG + Intronic
1193605286 X:83559864-83559886 ATGCTGTTCATGAAAATAGAGGG - Intergenic
1194743709 X:97605954-97605976 CTGCTATTATCGAAGATATAAGG - Intergenic
1195231799 X:102857722-102857744 ATGCTAATCTTGAATATAAATGG - Intergenic
1195579569 X:106485714-106485736 CTGCTGATCTGAAAGATTAAGGG + Intergenic
1196041543 X:111210247-111210269 TGGCTGTTCTTGAACAGAAAAGG - Intronic
1196324708 X:114389515-114389537 CTGCTGTTCTAGGAGCTGAAAGG - Intergenic
1197183075 X:123557537-123557559 CTGCTGGCTTTGAAGATGAAGGG + Intergenic
1198485975 X:137087866-137087888 ATGCTGCTCTTGAATATCAAGGG + Intergenic
1198502364 X:137264144-137264166 CTGTTGGTCTTGAAGATTCATGG - Intergenic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic