ID: 1142683193

View in Genome Browser
Species Human (GRCh38)
Location 17:1562229-1562251
Sequence CCGTGGGCCCCTCCATGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 295}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142683184_1142683193 -3 Left 1142683184 17:1562209-1562231 CCCGGGTTGTCCCTCCGTGCCCG 0: 1
1: 0
2: 1
3: 6
4: 84
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683173_1142683193 30 Left 1142683173 17:1562176-1562198 CCGAGGCCCCCGGGGCGCCTGAG 0: 1
1: 0
2: 1
3: 13
4: 282
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683175_1142683193 24 Left 1142683175 17:1562182-1562204 CCCCCGGGGCGCCTGAGGAGCCG 0: 1
1: 0
2: 0
3: 14
4: 153
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683178_1142683193 21 Left 1142683178 17:1562185-1562207 CCGGGGCGCCTGAGGAGCCGTCC 0: 1
1: 0
2: 0
3: 16
4: 139
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683177_1142683193 22 Left 1142683177 17:1562184-1562206 CCCGGGGCGCCTGAGGAGCCGTC 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683176_1142683193 23 Left 1142683176 17:1562183-1562205 CCCCGGGGCGCCTGAGGAGCCGT 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683183_1142683193 0 Left 1142683183 17:1562206-1562228 CCGCCCGGGTTGTCCCTCCGTGC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683185_1142683193 -4 Left 1142683185 17:1562210-1562232 CCGGGTTGTCCCTCCGTGCCCGT 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683181_1142683193 13 Left 1142683181 17:1562193-1562215 CCTGAGGAGCCGTCCGCCCGGGT 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295
1142683182_1142683193 4 Left 1142683182 17:1562202-1562224 CCGTCCGCCCGGGTTGTCCCTCC 0: 1
1: 0
2: 3
3: 8
4: 126
Right 1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG 0: 1
1: 0
2: 4
3: 26
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142683193 Original CRISPR CCGTGGGCCCCTCCATGCCC CGG Intronic
900014248 1:137677-137699 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
900044111 1:492879-492901 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
900065520 1:727785-727807 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
900335592 1:2161455-2161477 CCGAGGGCCCCTCACTGCCCAGG - Intronic
900346647 1:2213514-2213536 GCGAGGTCCCCTCCGTGCCCCGG - Intergenic
900415957 1:2534786-2534808 CCCTGGGCCCATCCATGCATAGG + Intergenic
900438404 1:2642001-2642023 CCCAGGGCCCCGCCATCCCCAGG - Intronic
900798453 1:4723528-4723550 ACGAGGACCCCTCCATGCTCTGG - Intronic
900946080 1:5832143-5832165 CCGTGGGCACGTCCAAGCTCAGG + Intergenic
901025826 1:6278268-6278290 ACGGTGGCTCCTCCATGCCCTGG - Intronic
901207028 1:7503259-7503281 CGGGAGGGCCCTCCATGCCCTGG - Intronic
902264567 1:15252713-15252735 CCGTGGGCCCCTCAGAGGCCAGG + Intronic
903068107 1:20712112-20712134 CCTTCGGCCCCTCTAGGCCCGGG + Intronic
904592249 1:31621419-31621441 CCGTGAGCCCCACCCTGCCCTGG - Intronic
904747676 1:32720936-32720958 CCGTGGCTCCCTCCCAGCCCTGG - Intergenic
905169027 1:36099004-36099026 CCGGGGGCACCCCCCTGCCCTGG + Exonic
905733176 1:40310272-40310294 CCTTGGGCCCTGCCATGCCTGGG + Exonic
906076629 1:43056663-43056685 CTTTGGGCCCCACCCTGCCCAGG + Intergenic
907404109 1:54243243-54243265 CCCTCGGCCCCGCCATGCCCGGG - Exonic
916439369 1:164807710-164807732 CCGGAGGCCCCGCCATGGCCAGG - Intronic
921390557 1:214609145-214609167 CCGTCGGTCCCTCCGCGCCCCGG + Intronic
923045685 1:230354080-230354102 ACCTGTGCCCCTCCATTCCCTGG - Intronic
924934210 1:248754832-248754854 CGGTGCACCCCTACATGCCCGGG + Intronic
1062768090 10:80542-80564 CCCTGGGCCCATCCCAGCCCTGG - Intergenic
1065019797 10:21494854-21494876 CCGTGGGAACCTCCAACCCCGGG - Exonic
1065971938 10:30812548-30812570 CCAGGGACCCCTCTATGCCCTGG + Intergenic
1068315485 10:55336352-55336374 AGGTGGGCACCACCATGCCCAGG - Intronic
1069898620 10:71694550-71694572 CCATAGGCCCCTCCTTGCCTTGG + Intronic
1070794116 10:79207140-79207162 TCCTAGGCCCCTCCCTGCCCTGG + Intronic
1074078711 10:110151468-110151490 CCGTGGACCCCTCCAGCACCAGG - Intergenic
1075103917 10:119524671-119524693 CCTGGGGCCCCTCTCTGCCCAGG + Intronic
1076668373 10:132105432-132105454 TCGTGGGCCTCCCCATCCCCCGG - Intronic
1076675131 10:132143778-132143800 ACGTGGGCCCATCCCTGCCACGG + Intronic
1076866530 10:133169010-133169032 CAATGGGCCACTCCCTGCCCGGG - Intronic
1076970445 11:129354-129376 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
1076995042 11:293705-293727 CCCAGGGCCCCGCCATGACCTGG + Exonic
1077168902 11:1157743-1157765 CCGAGGGCCCCCCCAAGCCCTGG - Intergenic
1077329957 11:1979817-1979839 CCGTGGCCCCCTCCCAGCCATGG - Intronic
1078466382 11:11553448-11553470 CCTGGGTCCCGTCCATGCCCTGG - Intronic
1080351143 11:31386845-31386867 CAGTGGGCTCCTCCTGGCCCAGG - Intronic
1080641538 11:34161226-34161248 GAGAGGGCCACTCCATGCCCAGG - Intronic
1080678379 11:34449263-34449285 CCGTGGGCCCCTTCTTGTTCAGG + Exonic
1082191732 11:49253495-49253517 TTGTGGGCACCTCTATGCCCTGG + Intergenic
1083428328 11:62601153-62601175 CCGAAGGCCACTCCGTGCCCCGG + Intronic
1083431463 11:62615564-62615586 CCCTCTGCCCCTCCAGGCCCAGG - Exonic
1083608147 11:63991344-63991366 CAGTGGGACCCCCCATGCCAAGG + Intronic
1083631346 11:64097071-64097093 CAGTGGGCACCGCCATCCCCGGG - Intronic
1083678334 11:64340260-64340282 CCTTGCCCCCCTCCATGCCCGGG - Exonic
1083889642 11:65589500-65589522 CCCTGGGCCCATCCACACCCAGG - Intronic
1083996960 11:66277559-66277581 CCGTGCACCCCACCAAGCCCAGG - Intergenic
1084573275 11:69972849-69972871 CAGTGGGACCCTCCCTGGCCTGG + Intergenic
1085015350 11:73170168-73170190 CCTTGGCCCCCTCATTGCCCAGG - Intergenic
1085774787 11:79355957-79355979 CCTTGGGCCCCTCAAACCCCTGG - Intronic
1085795253 11:79533362-79533384 CCATGAGGCCATCCATGCCCTGG - Intergenic
1086674391 11:89587527-89587549 TTGTGGGCACCTCTATGCCCTGG - Intergenic
1089011584 11:115136180-115136202 CCATGGGCCCCTCCCACCCCAGG + Intergenic
1089331235 11:117690404-117690426 CCGTGGGTGCCTCCATCCCTTGG - Intronic
1090974150 11:131667596-131667618 CTCTGGGTCCCTCCATGACCAGG - Intronic
1202812934 11_KI270721v1_random:34996-35018 CCGTGGCCCCCTCCCAGCCATGG - Intergenic
1091765491 12:3117566-3117588 CCGTGGGCCCAGCTCTGCCCCGG + Intronic
1092184777 12:6470744-6470766 CCGCGGCCCAATCCATGCCCAGG + Intronic
1094497106 12:30995288-30995310 CAGGGTGCCCCTCCCTGCCCAGG - Exonic
1096196577 12:49652461-49652483 GCATGGGCCCCTCAAAGCCCAGG + Intronic
1102781932 12:115572958-115572980 CCGTTGGACCTTCCCTGCCCAGG - Intergenic
1104376253 12:128267317-128267339 CCGCCGGCCGCCCCATGCCCGGG - Intergenic
1104728338 12:131091701-131091723 CTGTGGCCCCCTCCTCGCCCCGG - Intronic
1104934040 12:132355122-132355144 CCGTGGGGCCGTCCCTTCCCCGG + Intergenic
1104966897 12:132512395-132512417 GACTCGGCCCCTCCATGCCCCGG - Intronic
1104988208 12:132609416-132609438 GCGTGAGCCACCCCATGCCCGGG - Intronic
1105303687 13:19155235-19155257 CCCTGCCCCCCACCATGCCCTGG + Intergenic
1105405041 13:20126865-20126887 TAGTGGGCCCCACCATGCCCAGG + Intergenic
1106002651 13:25738577-25738599 TGGTGGGGCCCTCCAGGCCCAGG - Intronic
1106041414 13:26097092-26097114 GCGTGGGCCCCTCCTTACACAGG - Intergenic
1110258859 13:73462775-73462797 CCTTCTGCTCCTCCATGCCCAGG + Intergenic
1113634322 13:111909552-111909574 CCCTGGGCCCCTCTGTGCCCAGG - Intergenic
1114037712 14:18645500-18645522 CCCTTGGCCCTGCCATGCCCGGG - Intergenic
1114120920 14:19669521-19669543 CCCTCGGCCCCGCCACGCCCGGG + Intergenic
1117279019 14:54219577-54219599 CGGGGGGCCGCTCCCTGCCCAGG - Intergenic
1117547436 14:56804922-56804944 CAGTTGTTCCCTCCATGCCCAGG - Intronic
1117803014 14:59464495-59464517 CCCTGGGCTTCTCCTTGCCCTGG - Exonic
1118398159 14:65355186-65355208 CTGTGAGCCCCACCTTGCCCTGG + Intergenic
1118586200 14:67355854-67355876 CGGTGTGCCCTACCATGCCCAGG - Intronic
1118930375 14:70234884-70234906 CCCTGGGCCCCTCCACTGCCTGG + Intergenic
1119263536 14:73251785-73251807 CCCTGAGCGACTCCATGCCCGGG + Exonic
1119652239 14:76392124-76392146 CTGGAGGCCCCTCCCTGCCCCGG - Intronic
1122208450 14:100159875-100159897 CCCTGGGTCCCTCGATGCGCGGG + Exonic
1122268938 14:100559725-100559747 CCTGGGCCCCCTCCACGCCCTGG + Intronic
1122542414 14:102505747-102505769 CCCTGGACTCCTCCATGCCCAGG + Exonic
1123937841 15:25202603-25202625 CCTGGGCCTCCTCCATGCCCAGG + Intergenic
1124264215 15:28219316-28219338 CCGTGGGGCCACCCCTGCCCAGG + Intronic
1124706999 15:31974564-31974586 CCTTGGGCCGCTCCCTCCCCGGG - Intergenic
1125609474 15:40960783-40960805 CCGTGGACCCCAGCATGGCCAGG + Intergenic
1125745146 15:41992698-41992720 TCCTGGGCCCCACCCTGCCCTGG - Intronic
1125764142 15:42121844-42121866 CTGTGGACCCCTCCAGGGCCAGG - Intergenic
1129239182 15:74241536-74241558 CCGTGGGGCCCTCCAGGAGCTGG - Intronic
1129672724 15:77616126-77616148 CCCTGAGCCCCTCCATTCCAAGG - Intronic
1130353082 15:83108059-83108081 CCCTGGGCCCCTCCAGGGCAGGG - Intronic
1132604212 16:787006-787028 CGGTGGGTCCCTGCCTGCCCAGG + Intronic
1132625188 16:888209-888231 CCGTGGGTCCCTGCCCGCCCAGG + Intronic
1132874567 16:2130609-2130631 CCAGGGGCCCCTCCGTGGCCTGG + Intronic
1133049026 16:3106360-3106382 CCGAGGCCTCCTCCATGCCTGGG - Intergenic
1133225141 16:4337314-4337336 TCTTGTGGCCCTCCATGCCCAGG - Exonic
1134414192 16:14029802-14029824 CCATGGGAACTTCCATGCCCAGG - Intergenic
1134553511 16:15149442-15149464 CCAGGGGCCCCTCCGTGGCCTGG + Intergenic
1136294573 16:29294362-29294384 CCGTGTGACACTCCATCCCCAGG + Intergenic
1136367301 16:29814685-29814707 CCTTGGGCCCATCCCTCCCCTGG + Exonic
1136382478 16:29901883-29901905 CTGTGGGCCCACCAATGCCCGGG + Exonic
1136723564 16:32341120-32341142 CCCTGGGCCCGGCCCTGCCCTGG - Intergenic
1138416105 16:56872335-56872357 CCTTCGCCCCCTCCAGGCCCAGG + Exonic
1139582108 16:67879950-67879972 CTGTGGACCCCTCCTTGACCAGG + Exonic
1139969122 16:70762853-70762875 CCCTGGGCCCCTCCAAGCCAGGG - Intronic
1141842182 16:86580107-86580129 CTGCGGGCCCTTGCATGCCCGGG - Exonic
1141898864 16:86977170-86977192 CAGTTGGCCCCTTCATGTCCTGG - Intergenic
1142100478 16:88268406-88268428 CCGTGTGACACTCCATCCCCAGG + Intergenic
1142197232 16:88744527-88744549 CTGAGAGCCCCTCCCTGCCCAGG - Intronic
1142244935 16:88966044-88966066 CCCTGGGCCACTCCTTGGCCAGG + Intronic
1142417342 16:89949670-89949692 CCCAGGGTCCCTCCGTGCCCCGG + Intronic
1142449804 16:90168128-90168150 CGGTGGGCTCCTCCACGCCAAGG + Intergenic
1203002868 16_KI270728v1_random:176645-176667 CCCTGGGCCCGGCCCTGCCCTGG + Intergenic
1203134473 16_KI270728v1_random:1713051-1713073 CCCTGGGCCCGGCCCTGCCCTGG + Intergenic
1142457282 17:63718-63740 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
1142643657 17:1299132-1299154 CCGTGGCCCCCGCGATGGCCTGG + Exonic
1142683193 17:1562229-1562251 CCGTGGGCCCCTCCATGCCCCGG + Intronic
1142683218 17:1562297-1562319 CCGGCTGCCCCTCCACGCCCCGG + Intronic
1142683226 17:1562316-1562338 CCGGCCGCCCCTCCACGCCCCGG + Intronic
1142752254 17:1996034-1996056 CCCTGGGCCCTGCCCTGCCCTGG + Intronic
1143112106 17:4558632-4558654 CCGAGGGCACCTCCACCCCCAGG + Exonic
1143780733 17:9228021-9228043 CTGTGGGCCCCATCCTGCCCTGG + Intronic
1143848483 17:9791349-9791371 CCTTGGGCCTCCCCCTGCCCTGG - Intronic
1143868779 17:9943093-9943115 GCCTGGGCCCCTCCCAGCCCTGG - Intronic
1144788930 17:17846937-17846959 CCTTGGCCCTCTCCCTGCCCAGG + Exonic
1144851395 17:18245872-18245894 CCCAGGGCCCCTGCCTGCCCTGG + Intronic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1147262682 17:39217837-39217859 CCGTGGCCGCCTCAGTGCCCAGG + Intronic
1148106368 17:45120987-45121009 CCGTGGGCGCCGCCAGGTCCAGG + Exonic
1148463539 17:47851350-47851372 CCCTGGTCCCCTCCACTCCCAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150615120 17:66764460-66764482 CCCTGGTCCCTTTCATGCCCTGG + Intronic
1152238145 17:79149105-79149127 CTGCGGGAGCCTCCATGCCCTGG - Intronic
1152567544 17:81106922-81106944 CTGCGGGCCCCTCCCAGCCCCGG - Intronic
1154129881 18:11727453-11727475 AGGTGGGCACCACCATGCCCAGG - Intronic
1154446225 18:14437886-14437908 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1155310621 18:24519227-24519249 CCCTGGCCCCCTCCACCCCCCGG + Intergenic
1155369205 18:25080104-25080126 CCTTGGGCCCCTCCATGTCTGGG - Intronic
1157879332 18:51305067-51305089 CAGTGGGCCCCTTCTAGCCCAGG - Intergenic
1158539754 18:58342400-58342422 CTGTGGGCTTCTCCACGCCCTGG + Intronic
1158546113 18:58398861-58398883 CCTTGGGCCCCGACCTGCCCGGG + Intronic
1159121423 18:64175895-64175917 CTGTGTGCCCCAGCATGCCCTGG + Intergenic
1159460352 18:68715234-68715256 CGGTGCCCCCCTCCACGCCCAGG + Exonic
1160410619 18:78673321-78673343 CCGTGGCCCCCACCAGCCCCTGG + Intergenic
1160554222 18:79715550-79715572 CCGCGGGCCTGACCATGCCCAGG - Intronic
1160647641 19:200823-200845 CGGTGGGCTCCTCCACGCCAAGG - Intergenic
1160791769 19:926634-926656 CCGGGGGCCCCTCTCTGCGCTGG - Intronic
1160828025 19:1089764-1089786 TCGAGGTCCCCTCCAGGCCCTGG + Intronic
1160831530 19:1106822-1106844 CCAGGGGCCCCTCCATGTCAGGG + Intergenic
1161021759 19:2014428-2014450 CCTGGGTCCCCTCCATGCCCTGG - Intronic
1161226461 19:3148784-3148806 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161226469 19:3148801-3148823 CCCTGGGCCCCTGCCTGCCCTGG - Intronic
1161267996 19:3373920-3373942 CCTTGGGCCGCTCCTTCCCCTGG - Intronic
1161356963 19:3824540-3824562 CTGTGCTCCCCTGCATGCCCTGG - Intronic
1161395649 19:4043692-4043714 CCCTGGCCCCCTCCACCCCCTGG + Intergenic
1161484096 19:4525461-4525483 CCCTGGGCTCCTCCAGGCCCGGG + Intronic
1161487399 19:4543577-4543599 CCGGGGGCCCCCCGATGCCTTGG - Exonic
1162723124 19:12674179-12674201 CCGTCGGCTCCCCCTTGCCCAGG - Intronic
1163257117 19:16163031-16163053 AGGTGTGCCCCACCATGCCCAGG + Intronic
1163374373 19:16921433-16921455 CCCAGGGGCCCTCCCTGCCCTGG + Intronic
1163419010 19:17203847-17203869 CCATCGGCCCCTCCTTCCCCAGG + Intronic
1163553924 19:17982209-17982231 CCCTGGGCCCCTCCCGACCCTGG + Intronic
1163797477 19:19345846-19345868 ACGGGGGCCCCGCCAGGCCCTGG + Intronic
1165445810 19:35856329-35856351 CCCTCGGCCCCTCCTTTCCCAGG - Intronic
1166020667 19:40025564-40025586 CCCTGGGCTCCTCCATGGGCAGG + Intergenic
1166749119 19:45156350-45156372 CCCAGGGCCTCTCCATGCTCTGG - Intronic
1167117841 19:47498345-47498367 CCAGGGGCCCCTGCCTGCCCTGG - Intronic
1167240159 19:48338802-48338824 CTGTGGGTTCCTCCATACCCTGG - Intronic
1167619779 19:50554334-50554356 CCGGGTCACCCTCCATGCCCTGG + Intronic
1167892274 19:52550096-52550118 TCGTGGGATCCTTCATGCCCAGG + Intronic
1167912020 19:52711481-52711503 TCGTGGGATCCTTCATGCCCAGG - Intronic
925170829 2:1749449-1749471 CTGTGCACCCCTCCAGGCCCTGG + Intergenic
925352049 2:3208335-3208357 CCGTGAGCACCTCTGTGCCCGGG + Intronic
925723532 2:6851490-6851512 CCCTGGTCTTCTCCATGCCCCGG + Exonic
926289475 2:11517144-11517166 CTGTGGACCCCTCCAAGGCCAGG + Intergenic
926734844 2:16065494-16065516 GCCTGGGCTCCTCCATGCCAAGG + Intergenic
928379798 2:30807941-30807963 CCCTGGGTCTCGCCATGCCCAGG - Intronic
929107100 2:38376656-38376678 CCGCGGGGCCCATCATGCCCTGG + Intronic
929952721 2:46428826-46428848 CCCTGGGGCCCTCCAAACCCTGG + Intergenic
930206984 2:48597544-48597566 CTGTGGGTACCTCCCTGCCCAGG + Exonic
930664748 2:54090808-54090830 TCCTGGGCCACTCCATGCACGGG + Intronic
932347298 2:71004082-71004104 TCGGGGGTCCCTCCATGCCTTGG + Intergenic
932421741 2:71605436-71605458 TCGTGGGTCCCTGAATGCCCAGG + Intronic
932494594 2:72140150-72140172 CCTTGGACCCCTCCCTGCCTTGG + Intronic
933791565 2:85888064-85888086 CCGAGGTCCCTTCCAGGCCCCGG - Intronic
934729919 2:96650001-96650023 CCATGGGCCCCTTCATGCTCAGG - Intergenic
937992483 2:127672403-127672425 GCTTCAGCCCCTCCATGCCCAGG + Intronic
938246687 2:129782530-129782552 GTGTGGGCTCCTCCATGCCGGGG - Intergenic
938442961 2:131352535-131352557 CCCTCGGCCCCCCCATGCCCGGG - Intronic
940788349 2:158005820-158005842 CCGAAGGCCTCTCCATGGCCAGG + Intronic
942075183 2:172351046-172351068 GCGTGGGCCACTCCAGGCTCTGG + Intergenic
946399174 2:219459839-219459861 CCGTGGGCCCCTCCTCTGCCCGG + Intronic
947105826 2:226667108-226667130 AGGTGGGCACCACCATGCCCAGG - Intergenic
947654652 2:231816495-231816517 CCTTGGGCCTCTCTATTCCCTGG - Intergenic
948273628 2:236692086-236692108 CCGAGGGCCCATGCTTGCCCCGG - Intergenic
948518612 2:238521984-238522006 CCCTGGGTCCCTCCATTTCCAGG + Intergenic
948793503 2:240390982-240391004 CCCTGGGCCCGTCCACTCCCCGG + Intergenic
948816012 2:240510646-240510668 CTGTGGGCACCTCCTTGGCCTGG - Intronic
1171084015 20:22219324-22219346 CCAAGGACCACTCCATGCCCCGG + Intergenic
1171430090 20:25077667-25077689 CCGGGGGCCCTTCCTTACCCAGG + Exonic
1171432408 20:25091361-25091383 CCTGGGGCCCCTGCATGCCAGGG + Intergenic
1172091489 20:32435984-32436006 CCGTGTGCCTGTCCATGCCTGGG + Exonic
1172096866 20:32464588-32464610 GCGTGTGCCCCTCAGTGCCCGGG + Intronic
1172210830 20:33197343-33197365 CCGAGGGCCACTCCTAGCCCAGG + Intergenic
1172794995 20:37530678-37530700 CCTTGTTCCCTTCCATGCCCAGG + Intergenic
1173018528 20:39248152-39248174 CAGAGTTCCCCTCCATGCCCAGG - Intergenic
1173552399 20:43941763-43941785 CTGTGGGTTCCTCCTTGCCCTGG + Intronic
1173595911 20:44258310-44258332 CCCTGGGCACCCCCATGCTCGGG - Intronic
1174357783 20:50009959-50009981 CCGGGCGCCCCTCCAGGCCGCGG + Intergenic
1175619523 20:60431558-60431580 CCCTGGCCCCTTCCATGCCCCGG + Intergenic
1175766515 20:61596323-61596345 CTGTGAGCCAGTCCATGCCCTGG - Intronic
1175999925 20:62827157-62827179 ACGGGGGCCCCTCCAGGCCCGGG - Intronic
1176092900 20:63326757-63326779 CCCTGGCCCCTGCCATGCCCTGG - Exonic
1176241549 20:64077933-64077955 ACGGAGGCCCCTCCCTGCCCTGG - Intronic
1176449757 21:6851960-6851982 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1176619141 21:9043113-9043135 CTGTGGGCCCCCCCACCCCCCGG + Intergenic
1176827929 21:13716984-13717006 AAGAGGGCCCCTCCATGGCCTGG - Intergenic
1178664936 21:34538380-34538402 CCGTGGGCTCCTCCATCCTGAGG + Intronic
1179784218 21:43720356-43720378 CCGCAGGCCCCGCCGTGCCCAGG - Intronic
1179889375 21:44327931-44327953 CCTTAGGCCCCTCCAAGCCAGGG - Intergenic
1180059633 21:45378092-45378114 CCGTGGACCCCTCCAGAGCCTGG - Intergenic
1180461841 22:15572542-15572564 CCCTTGGCCCTGCCATGCCCGGG - Intergenic
1180957229 22:19746480-19746502 CCGTGGGCAGCCCCATCCCCAGG + Intergenic
1181121698 22:20671270-20671292 CCGTCGGTCCCTCCGCGCCCCGG + Intergenic
1181743078 22:24936803-24936825 CACTGGGCCCATCCATGCACTGG + Intronic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1183948234 22:41338791-41338813 CTGAGGGCCCCTCCCTGCTCTGG + Intronic
1184148798 22:42626953-42626975 AGATGGGCCCCTCCATGTCCAGG + Intronic
1184371099 22:44082640-44082662 TCACCGGCCCCTCCATGCCCCGG + Intronic
1184423900 22:44397738-44397760 CCGTGGGCTCCTCCATGCCACGG - Intergenic
1184648383 22:45908280-45908302 CACTGGGTCCCTGCATGCCCGGG + Intergenic
1184663733 22:45977011-45977033 CCGTGGACCCCTGCAAGCGCGGG + Exonic
1184878737 22:47291765-47291787 CCCTGGGCCCCGCCAGGCCTTGG - Intergenic
1185048680 22:48541884-48541906 CTGTGGCCCCCAACATGCCCCGG - Intronic
1185050838 22:48553258-48553280 CCGTGGAGGCCCCCATGCCCTGG + Intronic
1185140350 22:49097367-49097389 CCGTCTGCCTCTCCATGCCGTGG + Intergenic
1185143455 22:49116806-49116828 CCAGGGGCCCCTCCATGTGCTGG + Intergenic
1185164868 22:49255357-49255379 CCGGGGGCCCCTCCCTGCCCTGG + Intergenic
950124841 3:10504861-10504883 CCTGGGTCCCCTCCATGGCCAGG - Intronic
953753433 3:45627091-45627113 TCTGGGGCCACTCCATGCCCAGG + Intronic
953947553 3:47163299-47163321 GCGCGGGCCCCTCCACGGCCCGG + Intronic
954630448 3:52045061-52045083 CCGTGGGCCCACGCATGCCCGGG + Intergenic
961360470 3:126364224-126364246 CCGCAGGGCCCTCCATTCCCAGG + Intergenic
961773266 3:129265698-129265720 TCTTGGGCCCCTCCTGGCCCAGG - Exonic
966542417 3:181106886-181106908 CCTTGGGCCTCTCAAAGCCCTGG - Intergenic
968370206 3:198219292-198219314 CGGTGGGCTCCTCCACGCCAAGG + Intergenic
968661932 4:1802260-1802282 CCGTGGGCAGCTCCATGTCAGGG - Intronic
968934759 4:3604191-3604213 CCCTCGGCCCCTCAATGCACAGG - Intergenic
969506389 4:7590689-7590711 CCATGGTCCCATCCCTGCCCTGG + Intronic
969621197 4:8279775-8279797 CCGTGGGCTCTTCCAGGCCTGGG + Intronic
969674770 4:8608494-8608516 ACCTGGGCCCCTCCCTGTCCTGG + Intronic
969859334 4:10023317-10023339 CAGAGGGGCCCTCCATGCACAGG - Intronic
985484119 5:139417-139439 TCCTGAGCCCTTCCATGCCCTGG - Intergenic
995827033 5:116312042-116312064 TGGTGGGCCCCTGCAGGCCCAGG - Intronic
997643668 5:135466306-135466328 CCCCGGCCCCCTCCACGCCCTGG + Intergenic
997713987 5:136028847-136028869 CCGTGCGCCCCTGGCTGCCCTGG - Intergenic
999229297 5:150052337-150052359 CCCTGGGTCCCACCATGCTCAGG - Exonic
999432819 5:151538636-151538658 GCATGGACCCCTACATGCCCTGG + Intronic
999743792 5:154576552-154576574 CCCTGGGCCCATCCAGGCCAGGG + Intergenic
1001406796 5:171482344-171482366 CCCGGGGCCCCTCCCTGCCCAGG - Intergenic
1002060029 5:176620603-176620625 CCCTGGCCCTGTCCATGCCCCGG + Exonic
1002254544 5:177949656-177949678 CCGTGAGGCCCTCAGTGCCCAGG + Intergenic
1002301104 5:178257614-178257636 CAGTGGGCCCCTCCCTCCTCTGG + Intronic
1002483447 5:179518156-179518178 CCGTGAGGCCCTCAGTGCCCAGG - Intergenic
1002632715 5:180591646-180591668 CCGTGCCCCCTTCCCTGCCCGGG + Intergenic
1002729732 5:181326050-181326072 CGGTGGGCTCCTCCACGCCAAGG + Intergenic
1003259315 6:4502582-4502604 CTGTAGTCCCCACCATGCCCTGG + Intergenic
1003303328 6:4904512-4904534 CACTGCGCCCCTCCCTGCCCTGG + Intronic
1003874944 6:10426611-10426633 CCCTGGGCCCCTCCAGGCAGTGG - Intergenic
1007614325 6:43171496-43171518 CCCGGGGCCCCTGCACGCCCGGG - Exonic
1010696562 6:78981554-78981576 CCATGGGCTCCTTCATGCACTGG - Intronic
1011128911 6:84034329-84034351 CCGGGCGCGCCTCCATGCACTGG + Intronic
1012866194 6:104621095-104621117 ACCTGGGCCCCTCCAGGCACAGG - Intergenic
1019621797 7:1996142-1996164 CCGGGGGACCCTGCATGCCCAGG - Intronic
1019629198 7:2037784-2037806 CCTTGGGCCTCTCTATTCCCTGG + Intronic
1019723267 7:2586523-2586545 CCGCGGGCCACGCGATGCCCCGG + Intronic
1021781085 7:24106803-24106825 CCTTAGGCCCCTCCCAGCCCAGG + Intergenic
1023037685 7:36147570-36147592 CCGTGGTCCCCTGCTAGCCCTGG - Intergenic
1023904678 7:44513732-44513754 CCCTGGGACCCTTCCTGCCCTGG - Intronic
1024984776 7:55185518-55185540 CCGTGGAGCCTCCCATGCCCAGG + Intronic
1025181319 7:56825239-56825261 CGGTGGGCTTCTCCAGGCCCAGG - Intronic
1026735260 7:72945149-72945171 CCGTGGTCCCCTCCCTTCCCCGG - Intronic
1026785601 7:73300078-73300100 CCGTGGTACCCTCCCTTCCCCGG - Intergenic
1027108465 7:75419858-75419880 CCGTGGTCCCCTCCCTTCCCCGG + Intronic
1029259713 7:99293538-99293560 CTCAGGGCCCCTCCATTCCCTGG + Intergenic
1029947687 7:104550417-104550439 CTGTGGTCTCCTCCTTGCCCTGG - Intronic
1032199277 7:129808014-129808036 CCATTGGCCCATCCTTGCCCAGG + Intergenic
1032396227 7:131592013-131592035 CCCAGGGCCCCTCTGTGCCCAGG - Intergenic
1034281064 7:149854771-149854793 CTGTGGCCCCCTCCGTGCTCAGG + Intronic
1034589757 7:152129145-152129167 ACCTGGGCCCCACCAGGCCCTGG - Intergenic
1037877215 8:22554134-22554156 CCGTGGGGCTCTCCCTGCACGGG - Intronic
1038544154 8:28412469-28412491 CTGCGGCCCCCTCCTTGCCCTGG + Intronic
1039434783 8:37552595-37552617 CAGTGGGCCCTTCCCAGCCCAGG + Intergenic
1039557164 8:38484787-38484809 CTGGGGGCCCCTCCCAGCCCAGG - Intergenic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1045578090 8:103447720-103447742 CCATGGGCCCATCCATCCACAGG - Intergenic
1046676117 8:117110558-117110580 TCATGTGCCCCTGCATGCCCTGG - Intronic
1047746504 8:127848928-127848950 GCGTGGTCCACACCATGCCCTGG - Intergenic
1048759739 8:137780881-137780903 CCGTGTCCCCCACCCTGCCCAGG - Intergenic
1049224187 8:141441824-141441846 CCCTGGGCCACCCCCTGCCCTGG + Intergenic
1049593263 8:143472112-143472134 CCCTGGACCCCTGCCTGCCCTGG + Intronic
1053153523 9:35757422-35757444 TCGGGGGCCCCTCCTTGCCCTGG - Exonic
1054455411 9:65427790-65427812 CCCTTGGCCCCTCAATGCACAGG + Intergenic
1057596216 9:96418005-96418027 CCATGGGCGCCTCGAAGCCCCGG + Exonic
1058899598 9:109430779-109430801 CCGTGAAGCCCTCCATGACCTGG + Intronic
1060148045 9:121268567-121268589 TGGTGGTCCCCTGCATGCCCGGG - Intronic
1060932361 9:127497105-127497127 CCGTGGGCCCCGCCAGGCCCCGG + Intronic
1061878224 9:133555511-133555533 CCGTGGGCACATCCGAGCCCTGG - Intronic
1061976022 9:134068285-134068307 CCGTGGGCCGTTCCCCGCCCGGG + Intronic
1062020863 9:134318825-134318847 CCCTGGGCCCCTCAAAGTCCAGG + Intronic
1062169225 9:135125510-135125532 CCCTGGGGCTGTCCATGCCCTGG + Intergenic
1062335094 9:136061453-136061475 CCATGGGCCCCTCAATGGTCAGG - Intronic
1062599233 9:137312521-137312543 CCATGGGCCCCAACATCCCCAGG - Intronic
1062754146 9:138278562-138278584 CGGTGGGCTCCTCCACGCCAAGG + Intergenic
1203519427 Un_GL000213v1:32557-32579 AAGAGGGCCCCTCCATGGCCTGG + Intergenic
1203577704 Un_KI270745v1:21319-21341 CGGTGGGCTCCTCCACGCCAAGG + Intergenic
1187669538 X:21655938-21655960 CCGCAGGCCGCTCCAGGCCCAGG + Exonic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic
1199979488 X:152913161-152913183 CCCTGGGCCCCTCCAGGGCTAGG - Intergenic
1200211824 X:154350075-154350097 CCTGGGTCCCCTCCATGCCCAGG + Exonic