ID: 1142685064

View in Genome Browser
Species Human (GRCh38)
Location 17:1572784-1572806
Sequence TCACTCTCCCACCCACCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 2, 1: 0, 2: 4, 3: 57, 4: 544}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142685064_1142685069 7 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685069 17:1572814-1572836 CTGCCCACTTTGGCTGGGACTGG 0: 1
1: 1
2: 1
3: 17
4: 230
1142685064_1142685070 8 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685070 17:1572815-1572837 TGCCCACTTTGGCTGGGACTGGG 0: 2
1: 1
2: 0
3: 23
4: 169
1142685064_1142685076 28 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685076 17:1572835-1572857 GGGCACTGCTGGGGACAGCACGG 0: 1
1: 3
2: 13
3: 75
4: 650
1142685064_1142685075 19 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685075 17:1572826-1572848 GCTGGGACTGGGCACTGCTGGGG 0: 2
1: 0
2: 5
3: 43
4: 453
1142685064_1142685073 17 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685073 17:1572824-1572846 TGGCTGGGACTGGGCACTGCTGG 0: 1
1: 1
2: 5
3: 35
4: 417
1142685064_1142685077 29 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685077 17:1572836-1572858 GGCACTGCTGGGGACAGCACGGG 0: 2
1: 0
2: 7
3: 85
4: 449
1142685064_1142685068 2 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685068 17:1572809-1572831 CAGCACTGCCCACTTTGGCTGGG 0: 1
1: 1
2: 1
3: 20
4: 187
1142685064_1142685067 1 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685067 17:1572808-1572830 GCAGCACTGCCCACTTTGGCTGG 0: 1
1: 1
2: 2
3: 25
4: 192
1142685064_1142685074 18 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685074 17:1572825-1572847 GGCTGGGACTGGGCACTGCTGGG 0: 1
1: 1
2: 5
3: 47
4: 396
1142685064_1142685066 -3 Left 1142685064 17:1572784-1572806 CCTGAGGGTGGGTGGGAGAGTGA 0: 2
1: 0
2: 4
3: 57
4: 544
Right 1142685066 17:1572804-1572826 TGAGGCAGCACTGCCCACTTTGG 0: 1
1: 1
2: 2
3: 22
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142685064 Original CRISPR TCACTCTCCCACCCACCCTC AGG (reversed) Intronic
900432049 1:2607089-2607111 TCACTCTCCCAGCCTCCCTGTGG + Intronic
900585689 1:3431298-3431320 TAACCCCCCCACCCACCCCCAGG + Intronic
900642029 1:3692289-3692311 CCACACCCTCACCCACCCTCTGG - Intronic
900794370 1:4699097-4699119 TCATTGTCACACCCACCCTGGGG + Intronic
900966006 1:5959125-5959147 TCAGTCCCCCTCCCTCCCTCCGG + Intronic
901812879 1:11777815-11777837 TCCCTCTCCAGCCCATCCTCTGG + Intronic
902141846 1:14363372-14363394 GCTCACACCCACCCACCCTCTGG + Intergenic
902670137 1:17967552-17967574 TTACTCACCCACCCACTCACTGG + Intergenic
902777640 1:18684845-18684867 TCAGCCTCCCTCACACCCTCCGG - Intronic
903034628 1:20485908-20485930 TCTCTCCCCCACCCTCCCTCCGG - Exonic
903347729 1:22697998-22698020 TTCCACTCCCACCCACCCTGGGG - Intergenic
903460397 1:23516759-23516781 TCACTCTTCCCCCCACTCTCAGG + Intronic
903772396 1:25772145-25772167 TCACTCTGGCAGCCACCCTTGGG - Intronic
904068518 1:27773691-27773713 ACACTCCCCTTCCCACCCTCGGG - Intronic
904305373 1:29585463-29585485 TCTCTCTCCCACCCACAAGCTGG - Intergenic
904466846 1:30713324-30713346 TCACTCTCACACTCACATTCTGG + Exonic
904700649 1:32355940-32355962 GCCCTCTCCCACCCACCATTAGG - Intronic
905461316 1:38124707-38124729 CCACGCACCCACTCACCCTCTGG - Intergenic
905619047 1:39425321-39425343 TCACTCTACCACTAACCCTGGGG + Intronic
905738054 1:40344435-40344457 TCACTCTCCCCCGGGCCCTCTGG + Intergenic
906688586 1:47778238-47778260 TCTCACTCCCACCCATGCTCTGG + Intronic
908169541 1:61491155-61491177 CCACTCTCCCACTCATCCACCGG - Intergenic
908415535 1:63909949-63909971 TCACTCTCCCACACACTTCCAGG - Intronic
910477710 1:87624279-87624301 TTCCTCTCCCACCCCCCGTCAGG - Intergenic
910784869 1:90985461-90985483 CCACTCCCCAACCCAGCCTCAGG + Intronic
911371738 1:97002485-97002507 TCTCCCTCCCTCCCTCCCTCTGG + Intergenic
913189355 1:116400415-116400437 TGACTCTCCTCCCCACCTTCAGG - Intronic
914708859 1:150194611-150194633 TCAAGATCCCACCCACCTTCAGG - Intergenic
915304473 1:154969810-154969832 TCACTCCCCCACCCCCACCCTGG - Intronic
916228125 1:162510381-162510403 TAACGCCCCCACCCAGCCTCTGG + Intronic
916541143 1:165755738-165755760 TCCCTTTCCCATCCACCTTCTGG + Intronic
917617306 1:176759160-176759182 TCAGTATCCCACCCTCCCCCAGG - Intronic
917700555 1:177576313-177576335 TCACTCACCCTCACCCCCTCAGG + Intergenic
918947486 1:191086858-191086880 TCACTCTCCACCTCTCCCTCTGG - Intergenic
919874262 1:201851045-201851067 TCACTCTGTCACCCAGGCTCAGG + Intronic
919924322 1:202184686-202184708 ACACCCACCCACCCACCCACAGG + Intergenic
920040662 1:203093573-203093595 TCACTCTGCCACCCAGGCTGGGG - Intronic
920185429 1:204156399-204156421 CCACCCACCCACCCACACTCAGG - Intronic
920433661 1:205934974-205934996 TCACTCTCCCTCACTCCCTTGGG - Intronic
920853119 1:209642505-209642527 TCACTCTCTCACCCAGACTCTGG + Intronic
921172983 1:212565608-212565630 TCACTTTCCCACCCCTCTTCTGG - Intronic
921711608 1:218378641-218378663 TCACTCTGCCACCCAGTCTGGGG + Intronic
921930802 1:220752815-220752837 TCACTCTATCACCCAGGCTCTGG - Intronic
922169461 1:223142830-223142852 TCACTCTCGCCCCCACCCTGTGG - Intronic
923251174 1:232180676-232180698 TCCCTCCCCCACCCTCCCACGGG - Intergenic
923365698 1:233258655-233258677 TCTCTGTGCCAACCACCCTCAGG + Exonic
923498114 1:234542367-234542389 CCACTGTCCCACTCTCCCTCTGG + Intergenic
1064261699 10:13791436-13791458 TCACACACACACCCACCCGCAGG - Intronic
1065553232 10:26889351-26889373 TCACTCTGCCACCCAGGCTGCGG - Intergenic
1066581594 10:36887704-36887726 TCACTCTGCCACCCAGGCTGGGG - Intergenic
1067264458 10:44725646-44725668 TCACTCACCACCCCACACTCAGG + Intergenic
1067499269 10:46787023-46787045 TCACTCTCCCAACGACCCTCGGG - Intergenic
1067527394 10:47046848-47046870 CCACCCTCCCGCCCACACTCAGG - Intergenic
1067595360 10:47553301-47553323 TCACTCTCCCAACGACCCCCGGG + Intergenic
1067721993 10:48734848-48734870 TCACTGTACCCTCCACCCTCAGG + Intronic
1068197615 10:53738196-53738218 TCACTCTCCCAACCCCCTTAAGG - Intergenic
1069381245 10:67844841-67844863 TCACTCTCTCACCCAGGCTGGGG - Intergenic
1069527633 10:69187378-69187400 TCACTCTGTCACCCAGGCTCTGG + Intronic
1069626376 10:69870342-69870364 TCACTCTCTCACCCAGGCTGGGG + Intronic
1069703372 10:70441785-70441807 TCTCTCTGCCCCCCACCCTCCGG - Intronic
1069994177 10:72332488-72332510 TCCCTCCCCCCCACACCCTCAGG - Intergenic
1070099151 10:73368507-73368529 TCACCCTCCTACCCAGCCCCTGG - Intergenic
1070341687 10:75504043-75504065 TCACTCTACCACTCAGGCTCTGG + Intronic
1070886607 10:79905197-79905219 TCCCTCTCCCAACGACCCCCGGG - Intergenic
1071054016 10:81487802-81487824 TCTCTCTCCCTCCCCCCCTTAGG + Intergenic
1071147909 10:82596951-82596973 TCATTCTTCCCCCCACCCTGTGG + Intronic
1071493639 10:86153224-86153246 TCACTCACACACACACGCTCAGG + Intronic
1072375214 10:94808583-94808605 TCACTGTCCCTCCCAGCCTCTGG + Intronic
1072501305 10:96020601-96020623 TCTCTCTCCCTCCCTCCCTCTGG - Intronic
1072842526 10:98790473-98790495 TCCTTCTCCCTCCCAGCCTCTGG - Intronic
1073266147 10:102229676-102229698 TCACCCTTCCACACACCCTCAGG - Intergenic
1074034428 10:109724130-109724152 TCACAGTCTCACCCATCCTCTGG - Intergenic
1074167842 10:110901247-110901269 TCACTCTGCCACCCAGGCTTGGG - Intronic
1074782507 10:116812035-116812057 TCCGTCTCCCACTCAGCCTCTGG - Intergenic
1075212794 10:120505262-120505284 ACACTCTGCCCCCAACCCTCAGG - Intronic
1075516339 10:123111597-123111619 TCCCTCTCTCTCCCAGCCTCAGG - Intergenic
1075630467 10:123997805-123997827 TCCCTCACCCCTCCACCCTCAGG + Intergenic
1076429987 10:130395048-130395070 TCACCCTGCCACTCACTCTCAGG - Intergenic
1076477773 10:130764600-130764622 TTACTCTCTGGCCCACCCTCTGG + Intergenic
1076811571 10:132888972-132888994 TCCCGCCTCCACCCACCCTCTGG + Intronic
1077251308 11:1561884-1561906 TCAGGCTCCCTCCCACCCTGTGG - Intronic
1077375209 11:2202454-2202476 CCCCTCCCCCACCCACCCTGGGG + Intergenic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1078095374 11:8293165-8293187 TCACTCTCCCTTCTGCCCTCAGG - Intergenic
1080388218 11:31822713-31822735 TCACACTCTCACCCACCTTACGG - Intronic
1081446347 11:43134790-43134812 TCACTCTCCCATACAAACTCTGG + Intergenic
1081657403 11:44866564-44866586 TCAGTCTCCCAACCATTCTCTGG + Intronic
1081670446 11:44939408-44939430 TCCCACTTGCACCCACCCTCTGG + Intronic
1081781231 11:45714456-45714478 TCATCCTCCCAGCCACTCTCTGG + Intergenic
1083248879 11:61452070-61452092 TCACTCTGCCACCCAGGCTGGGG + Intronic
1083711467 11:64552014-64552036 TCCCACCTCCACCCACCCTCGGG - Intergenic
1084688112 11:70709177-70709199 TCACTCTGCCACCCAGGCTGTGG - Intronic
1085204735 11:74724554-74724576 TCACTCTTCCACCAGCCCCCAGG + Intronic
1085658001 11:78334405-78334427 TCACTCCCCTTCCCAGCCTCTGG + Intronic
1086280268 11:85177513-85177535 TCACTCTGCCACCCACTGTAAGG - Intronic
1087165059 11:94994775-94994797 TCTCTCTCCCACCCAACCCCAGG - Intronic
1088076734 11:105858660-105858682 TCACTATCCTTCCCAGCCTCTGG + Intronic
1088648398 11:111936796-111936818 TCCCTTTCCCACCCACCTTCTGG + Intronic
1089072918 11:115715264-115715286 CCACTTTCACACACACCCTCAGG - Intergenic
1089259609 11:117214969-117214991 CCACTCTCCCTCCTACCCTCAGG + Intronic
1089361272 11:117888395-117888417 TCACTCTCCCACTCTCTCTTTGG + Intergenic
1089436240 11:118470334-118470356 TCACTCTGTCACCCAGGCTCTGG + Intronic
1089574901 11:119435159-119435181 TCACCCTCACAGCCACCCTCAGG + Intergenic
1089595303 11:119575024-119575046 TCACTCTGTCACCCAGCCTGGGG - Intergenic
1089695215 11:120212243-120212265 CCACCCACCCACCCACCCACCGG - Intronic
1089846967 11:121466265-121466287 CCACCCTCCCACCCACTCCCAGG + Intronic
1090239941 11:125174855-125174877 CCACTCTGCCCCCCACCCACCGG + Intronic
1090483228 11:127086397-127086419 GCCCTCTCCAACTCACCCTCAGG + Intergenic
1090981115 11:131723300-131723322 ACACTCTCCCATCCATCATCAGG - Intronic
1091002817 11:131924706-131924728 TCACACCCCCACCCACCAGCTGG + Intronic
1091615408 12:2047362-2047384 TCATTCTCACAACCACCCTATGG + Intronic
1091826220 12:3514711-3514733 TCCCTCCCCCACCCTCCCACTGG - Intronic
1092283417 12:7114473-7114495 TAACCCTCACACCAACCCTCTGG - Intergenic
1092420775 12:8329957-8329979 TCACTCTCTCACCCAGACTAGGG + Intergenic
1092944684 12:13441747-13441769 TCTCTCTTCTTCCCACCCTCAGG + Intergenic
1093376069 12:18429472-18429494 ACCCTCTCCCAGCCACCATCTGG + Intronic
1093627510 12:21366396-21366418 TCCCTCCCCCGCCCACCCCCCGG - Intronic
1094200881 12:27793508-27793530 TCACTCTGTCACCCAGCCTGGGG - Intronic
1094412636 12:30183143-30183165 TCACTGTAACACACACCCTCTGG + Intergenic
1095054688 12:37585057-37585079 TCACTCTATCACCCACACTGGGG - Intergenic
1095130966 12:38541771-38541793 TCTCTGTCCCACCTCCCCTCTGG - Intergenic
1095402476 12:41830819-41830841 CCTCTCTCCCTCCCTCCCTCTGG - Intergenic
1096071000 12:48775531-48775553 TGGCTCTCCCTCCCTCCCTCAGG - Intronic
1096421311 12:51460360-51460382 TCACTCTGTCACCCACACTGGGG - Intronic
1096539897 12:52301240-52301262 TCTCTCTCTCTCCCACTCTCTGG - Intronic
1097022164 12:56028089-56028111 TGCCTCTCTCACCCATCCTCTGG + Intronic
1097232881 12:57522946-57522968 ACCCCCTCCCACTCACCCTCTGG + Exonic
1097251112 12:57632742-57632764 TCCCACCCCCACCCACCCCCGGG + Intronic
1097503201 12:60432270-60432292 TCGCTCACCCTCTCACCCTCAGG - Intergenic
1097770441 12:63578300-63578322 TCACTATCCTTCCCAGCCTCTGG - Intronic
1097815405 12:64068365-64068387 TCACTCTGCCACCCAGGCTGGGG + Intronic
1098358233 12:69630875-69630897 TCACTCTGTCACCCACACTGGGG + Intergenic
1100480471 12:94973019-94973041 TCACTTTTCCCCCCACCCCCGGG - Intronic
1100924935 12:99534739-99534761 TCACTCTCTCACCCAGGCTGGGG + Intronic
1101488127 12:105185933-105185955 TCATTCCTCCTCCCACCCTCTGG + Intronic
1102500801 12:113351005-113351027 TCACTCTGCCACCCAGGCTGGGG - Intronic
1102723086 12:115034602-115034624 CCACCCTCCAACCCATCCTCGGG + Intergenic
1102884186 12:116508967-116508989 TCAGTCCCCCACCCACGCTTGGG + Intergenic
1102961872 12:117098672-117098694 TAAGTCTCCCAGCCACCCGCGGG + Intronic
1103469320 12:121167282-121167304 TCACTCTCCCTACCCCCGTCTGG - Intronic
1103831079 12:123779592-123779614 TCTCTCTCTCCCCCACCCCCAGG - Intronic
1105531802 13:21227561-21227583 TCCCTTTCCAACCCATCCTCCGG + Intergenic
1105635897 13:22215009-22215031 TCACTCTCTCGCCCAGGCTCTGG - Intergenic
1105899533 13:24743371-24743393 CCCATCTCCCACCCACCCTGTGG + Intergenic
1106233664 13:27843082-27843104 TCACTTTCTCACCCAGCCTGGGG + Intergenic
1106452259 13:29893985-29894007 GCACACTCCCACCCATTCTCTGG + Intergenic
1106677604 13:31977555-31977577 TCACTCTGCCACCCAGGCTGGGG - Intergenic
1107419519 13:40233528-40233550 CCACTCTCCCTCCCATGCTCAGG - Intergenic
1109008197 13:56905678-56905700 TCACTCTCACAGTCACTCTCAGG + Intergenic
1109881802 13:68487728-68487750 TCCCTCTCCCACACACACTTTGG - Intergenic
1109882467 13:68498199-68498221 TCACACTCACACCAACTCTCTGG - Intergenic
1111426591 13:88092705-88092727 TCACTCTACCCCCCAGCTTCAGG - Intergenic
1111849677 13:93556706-93556728 TCACTCCCCTTCCCAACCTCTGG + Intronic
1112128936 13:96499788-96499810 GCACCCTCCCACCCACACTTGGG - Intronic
1112748052 13:102550567-102550589 TCATTCTCCCACTCTTCCTCCGG + Intergenic
1113511850 13:110862795-110862817 CCACCATCCCACCCACCCTCAGG + Intergenic
1113881397 13:113628749-113628771 GCACTGTCCCATCCACCCTTTGG + Intronic
1114273356 14:21119084-21119106 TCACTCTGTCACCCAGGCTCTGG + Intergenic
1114543861 14:23483847-23483869 TCATTCTCCCACCTACTCTTCGG - Intronic
1114617892 14:24077866-24077888 TGACTCTCCCACCCCCTCCCAGG + Exonic
1115483188 14:33882959-33882981 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1115862303 14:37700715-37700737 TCACTCTGTCACCCAGTCTCAGG - Intronic
1116379216 14:44244369-44244391 TCACCCTCCAACTCAACCTCTGG - Intergenic
1116538345 14:46064554-46064576 CCACTCTCCCTCCCAACCCCTGG + Intergenic
1117344314 14:54817873-54817895 TCACTCTCCCAACCCATCTCAGG + Intergenic
1117394268 14:55293208-55293230 TCACTCTGCCACCCAGGCTGTGG + Intronic
1117418811 14:55523520-55523542 CCACTATCCTTCCCACCCTCTGG - Intergenic
1118198521 14:63650507-63650529 TCTCACCACCACCCACCCTCTGG - Intergenic
1118721972 14:68600756-68600778 TCACTCTCCCAGCCTCCTTTAGG + Intronic
1118748283 14:68789661-68789683 TGACTCTCCCCCCAGCCCTCAGG - Exonic
1118971293 14:70640937-70640959 TACCTCTCCCTCCCCCCCTCAGG + Intergenic
1119329638 14:73784489-73784511 CCACTCTCCCAGCTACACTCTGG + Intronic
1119385085 14:74253015-74253037 TCACTCTGCCACCCAGGCTGGGG - Intronic
1119620817 14:76130805-76130827 CCCCTTTCCCACCCACCTTCTGG + Intergenic
1120086856 14:80285442-80285464 TCACTATCCTTCCCAGCCTCAGG - Intronic
1120138868 14:80904324-80904346 CCCCTCTCCCCGCCACCCTCTGG - Intronic
1120940939 14:89948823-89948845 TCACTATCCTTCCCAGCCTCTGG - Intronic
1121130702 14:91443684-91443706 TCGCTCTGCCACCCAGGCTCTGG - Intergenic
1122024539 14:98866144-98866166 CCACTCCCCAACCCAACCTCTGG - Intergenic
1122201354 14:100124504-100124526 TGTCTCACCCACTCACCCTCAGG + Intronic
1122457369 14:101864819-101864841 CAGCTCTCCCACCCAACCTCAGG - Intronic
1122986737 14:105215002-105215024 CCACACTCCCACCCCCACTCAGG - Intronic
1123089760 14:105737348-105737370 TGACGCTCCCACTCACCATCTGG + Intergenic
1123982341 15:25615329-25615351 TCACTGTCACACTGACCCTCAGG + Intergenic
1124614001 15:31228717-31228739 TCACTCTGTCACCCACGCTAGGG + Intergenic
1125832869 15:42728918-42728940 TCAGCCCCACACCCACCCTCTGG + Intronic
1125874175 15:43129576-43129598 TCTCTCTCACACCTATCCTCTGG + Intronic
1126723502 15:51607126-51607148 TCACTCTGTCACCCAGGCTCTGG - Intronic
1126740373 15:51771078-51771100 TAACTCCCCCACCAACCATCTGG - Intronic
1126828112 15:52571336-52571358 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1127111235 15:55673417-55673439 TGACTCTCCCAGCCCCACTCTGG + Exonic
1127219453 15:56862623-56862645 TCACTACCCTTCCCACCCTCTGG - Intronic
1127902977 15:63354828-63354850 TCAGCCCTCCACCCACCCTCAGG + Intronic
1128446298 15:67764298-67764320 TCAAGGTCCCTCCCACCCTCAGG + Intronic
1128502717 15:68238973-68238995 TAACTCTCCCCACCAACCTCGGG - Intronic
1128505989 15:68273176-68273198 CCACCCTCCCACACACACTCTGG - Intergenic
1128518845 15:68362008-68362030 CCACTCACCCACCCACCATACGG + Intronic
1128810324 15:70566651-70566673 TTGCTCTCCCACCCAGCCCCGGG - Intergenic
1129081152 15:73042266-73042288 TCTCTCCCCCACACACCCTCGGG - Intergenic
1129311931 15:74718861-74718883 CCACTCCCCAACCCAGCCTCTGG + Intergenic
1129410721 15:75348883-75348905 GGACTCTGCCACCCTCCCTCAGG + Exonic
1131047435 15:89325033-89325055 TCACTCACTCACTCACTCTCTGG - Intronic
1132457444 16:32012-32034 TCACATTCCAACCCACTCTCAGG + Intergenic
1133403952 16:5508510-5508532 GCAATCTCCCACCCGACCTCGGG - Intergenic
1133575729 16:7087327-7087349 TGAATCTCCCACCCGCCATCAGG + Intronic
1133924369 16:10181800-10181822 TCCCTCTCCCGCTCTCCCTCCGG + Intronic
1134753330 16:16644506-16644528 TCACTCACCCCCCCACCCTCTGG + Intergenic
1134992727 16:18714577-18714599 TCACTCACCCCCCCACCCTCTGG - Intergenic
1135134262 16:19876100-19876122 TCATCCTCCCAGCCACCCTGGGG - Intronic
1135223977 16:20639498-20639520 CTCCTATCCCACCCACCCTCTGG + Intronic
1135582479 16:23640470-23640492 TCACTCTGCCACCCATGCTGGGG - Intronic
1136989075 16:35140941-35140963 AGACTCTCCCACACACCATCTGG - Intergenic
1137015442 16:35369672-35369694 TCACAATCCCACCCATTCTCAGG + Intergenic
1137405966 16:48189720-48189742 ACACTTTCCCACCCGGCCTCTGG - Intronic
1137531256 16:49280392-49280414 TCTCTCTACCCCTCACCCTCCGG + Intronic
1137697323 16:50469842-50469864 TCACTCTTGCACCCGCCCGCGGG - Intergenic
1137709165 16:50554664-50554686 TCACTCTGCCACCCAGGCTGGGG + Intronic
1138982277 16:62283728-62283750 TAATTCTCCCACCCACCCTTTGG - Intergenic
1139407037 16:66727352-66727374 TCACTCTGTCACCCAGCCTGTGG - Intronic
1139822515 16:69731672-69731694 TCACTCTGCCACCCAAACTGGGG - Intergenic
1141615996 16:85209712-85209734 AGACTCTCCCTCCCAGCCTCGGG - Intergenic
1141675217 16:85514103-85514125 TCACTCTCCCTGCCTCCTTCTGG + Intergenic
1141809446 16:86365174-86365196 TCAGCCACCCACCCACCCCCAGG + Intergenic
1141887302 16:86901386-86901408 TCATTTTCACACTCACCCTCTGG - Intergenic
1142669023 17:1478910-1478932 TCCCTCTACCACCTTCCCTCTGG - Intronic
1142677100 17:1520633-1520655 TCCCTTCCCCACCCACCCACTGG - Intronic
1142685064 17:1572784-1572806 TCACTCTCCCACCCACCCTCAGG - Intronic
1142687857 17:1588010-1588032 TCACTCTCCCACCCACCCTCAGG - Intronic
1142927723 17:3255752-3255774 CCACTCCCCTTCCCACCCTCGGG - Intergenic
1143172452 17:4938113-4938135 GCACCCTCCCACCCACCTCCAGG + Intronic
1143190104 17:5034461-5034483 CCTCCCTCCCACTCACCCTCTGG + Exonic
1143314513 17:6022182-6022204 TCACGTTTCCACCCACCCCCTGG + Intronic
1144068489 17:11645719-11645741 TCCCTTTGCCACCCAACCTCTGG + Intronic
1144080623 17:11760827-11760849 TCACTCTCACAGCCACCCTGCGG + Intronic
1144449489 17:15364390-15364412 TCCCTCCTCCACCCACACTCAGG + Intergenic
1144493676 17:15734291-15734313 TCACCCTCCACCCCACCCACAGG - Intronic
1144906589 17:18642361-18642383 TCACCCTCCACCCCACCCACAGG + Exonic
1144993349 17:19249293-19249315 TCTCCCTCCCAGCCACCCTCAGG - Intronic
1145375365 17:22342537-22342559 TCACTCTGTCACCCACGCTGGGG - Intergenic
1145987599 17:29057636-29057658 TCACCCCTCCACCCACCCTGGGG - Intergenic
1147761004 17:42797349-42797371 TCTCTCTCCCTCCCTCTCTCTGG + Intronic
1147969150 17:44210494-44210516 TCAGCCTTCCACCCACCCCCAGG + Intronic
1148911806 17:50946966-50946988 TCACTCTGCAAACCCCCCTCTGG + Intergenic
1150787296 17:68173350-68173372 TCACTCTCACACCCAGGCTGTGG - Intergenic
1151487847 17:74412929-74412951 TCACTCTCTCACCCAGGCTGCGG + Intergenic
1151858409 17:76738878-76738900 GCAGTCTCCCTCCCACCCTTGGG - Intronic
1152030301 17:77838086-77838108 CAGCTCTCCCACCCACCCTTAGG - Intergenic
1152120371 17:78414703-78414725 TCACTCTTCCACCCCCACCCCGG - Intronic
1152239726 17:79155020-79155042 CCCCTCCCCCACCCACCCTTTGG - Intronic
1152357185 17:79813069-79813091 TCAGTCTCCCCCACACCCTCTGG - Intergenic
1152738322 17:82008217-82008239 GCAGTCTCCCACCCAGCCACGGG - Intronic
1152757850 17:82094390-82094412 TCACACACCCACCCACCCTAGGG - Intronic
1154999169 18:21669938-21669960 TCACTCTGCCACTCTCCCGCGGG - Intronic
1156372599 18:36484915-36484937 TTACTGTGCCCCCCACCCTCAGG + Intronic
1156841392 18:41614132-41614154 TCACTCTCCCCCTCCTCCTCTGG + Intergenic
1157653028 18:49356523-49356545 TCACTCCTCCACCCACCTTACGG + Intronic
1159798217 18:72868170-72868192 TCGCTATCCCACCCAGGCTCCGG - Intergenic
1159970246 18:74642265-74642287 TCATTCTCCCACTCATCTTCAGG - Intronic
1160389807 18:78521575-78521597 TCCCTCTCCCACGCATCCTGCGG - Intergenic
1161504205 19:4635480-4635502 ACACCCACCCACCCACCCACAGG + Intergenic
1161558026 19:4955397-4955419 TCACTCTCCCGCCCTCTCTCGGG + Intronic
1162572444 19:11481000-11481022 CCACCCTCCCTCCCTCCCTCCGG + Exonic
1162726096 19:12690382-12690404 TCAGTCTTGCATCCACCCTCAGG + Intronic
1162954794 19:14091640-14091662 TCACCCACCCACACACCCCCAGG - Intergenic
1163127234 19:15250919-15250941 CCACTCTCCCACCACCCCTAGGG - Intronic
1163410398 19:17150374-17150396 TCACTCTGCCACCCAGGCTGGGG - Intronic
1163462255 19:17446128-17446150 TCCCTCACCCACCCATCCACTGG + Intronic
1163497919 19:17657343-17657365 GCAAACTCCTACCCACCCTCTGG + Intronic
1163831063 19:19547386-19547408 TCAATCTCCCACCCATTCACTGG + Intergenic
1163860452 19:19740060-19740082 TCACCCTCCAACCAACCCTCCGG - Intergenic
1164533192 19:29063476-29063498 TCTTTCTCCCTCCCACCCTCAGG + Intergenic
1164626726 19:29734261-29734283 TCACTCCCCCCGCCACCCCCTGG + Intergenic
1164706695 19:30325270-30325292 TGACTCTCACCCCCACCCTTGGG + Intronic
1164892430 19:31836261-31836283 TCACTCTCTTTCCCAGCCTCTGG - Intergenic
1165418872 19:35712773-35712795 TCACTCACACACCCACCCCCAGG + Intronic
1165748760 19:38247160-38247182 TCACTCTGCCACCCACACTGGGG - Intronic
1165780825 19:38433522-38433544 TCTCTCTCCCACCCCACCTCCGG + Intergenic
1166075869 19:40413470-40413492 TTTCTCCACCACCCACCCTCTGG - Intergenic
1166788565 19:45384107-45384129 TCACTCTGCCACCCAGGCTGCGG + Intronic
1166834602 19:45659517-45659539 TCACTCTCTCTCTCTCCCTCTGG - Intergenic
1166930940 19:46301009-46301031 GCCCTCTCGCCCCCACCCTCTGG + Intronic
1167413980 19:49361000-49361022 TCTCTGTCCCCCCCTCCCTCTGG - Intronic
1167413989 19:49361023-49361045 TCTCTGTCCCCCCCTCCCTCTGG - Intronic
1167552327 19:50169732-50169754 TCTCTGTCCCCCCAACCCTCTGG + Intergenic
1168291837 19:55360957-55360979 ACCTTCTCCCACCCACCCACCGG + Intronic
1168344346 19:55643095-55643117 TCACTCCCACACACACCCCCTGG + Exonic
1168516131 19:57011658-57011680 TCTCTCTCACACACTCCCTCGGG + Intergenic
1168695108 19:58399923-58399945 TCCCTCTCCCACCCAACCTAGGG + Intergenic
925804709 2:7636856-7636878 TCACTCTGCCACCCAGGCTGGGG + Intergenic
925933870 2:8734211-8734233 TCACTAACCCCCCCACCCCCAGG - Intronic
926750774 2:16197043-16197065 TCATTCTCACAGCAACCCTCAGG - Intergenic
927223365 2:20736408-20736430 TCACTCTGCCACCCAGGCTAGGG - Intronic
927855984 2:26528249-26528271 ACCCTCTCCCAACCCCCCTCAGG - Intronic
929447052 2:42009941-42009963 TCAATCTCACACCCACACTTTGG + Intergenic
930688722 2:54336796-54336818 TCACTCCCTCACTCTCCCTCTGG - Intronic
931653377 2:64488668-64488690 TCACTCTCCCTCCCACCTGCCGG - Intergenic
932071874 2:68628755-68628777 TATCTCTCCCACTCACCATCAGG + Intronic
932191298 2:69743085-69743107 TCACTCTGCCTCCCAGGCTCAGG + Intronic
932421380 2:71603418-71603440 GGTCTCTGCCACCCACCCTCTGG - Intronic
932458704 2:71867262-71867284 TCGCTCTCCCTCCTAACCTCTGG + Intergenic
933599554 2:84315813-84315835 TCACTCTCCACCCTACCTTCTGG - Intergenic
933769376 2:85733588-85733610 TGACTCTCCTGCCCACCCTGGGG + Intergenic
934517034 2:94994712-94994734 TCAAACTGCCCCCCACCCTCAGG + Intergenic
934518975 2:95007393-95007415 TCACTCTCTCACCTGGCCTCTGG + Intergenic
935223915 2:101037331-101037353 CTGCTCTCCCACCCACCCTTCGG - Intronic
935821290 2:106895494-106895516 TGTCTCTGCCACCCACCCCCTGG + Intergenic
935914932 2:107938722-107938744 TCACTCAGCCACCCAGGCTCGGG - Intergenic
936042616 2:109161341-109161363 TCTCTCTCCCACCTACCAGCTGG + Intronic
936292613 2:111238116-111238138 TCACACTCACACGCACACTCTGG - Intergenic
936855945 2:116957451-116957473 TCACCCTCACACACACCCTCAGG + Intergenic
937059275 2:118969455-118969477 TCTCTCTCTCTCCCTCCCTCAGG - Intronic
937125888 2:119474785-119474807 TCACTGTTCTACCCACCCACCGG + Intronic
937260085 2:120579771-120579793 TCAATCTCCCTCCCAGCCCCAGG + Intergenic
938305795 2:130253231-130253253 TCCCTCTGCTACCCACACTCGGG + Intergenic
938448353 2:131394532-131394554 TCCCTCTGCTACCCACACTCGGG - Intergenic
939707409 2:145471981-145472003 TCACTACCCTACCCAGCCTCTGG + Intergenic
940295168 2:152114983-152115005 TCACTCTCTCACCCAGGCTGGGG - Intergenic
940323215 2:152399150-152399172 TCACTCTCAAACCCGACCTCAGG - Intronic
940929786 2:159414256-159414278 TCACTATCCTTCCCAGCCTCTGG - Intronic
941455239 2:165707234-165707256 TAGCTCTGCCACCCACCTTCAGG + Intergenic
942469357 2:176243561-176243583 TGTCTCCCCCACCCACCCTCAGG + Intergenic
942960121 2:181820396-181820418 TCACTCTGTCACCCAGCCTGGGG + Intergenic
944014722 2:195021674-195021696 TCACTGTCCCTTCCACCCTTAGG + Intergenic
945053255 2:205846032-205846054 GGACTGTCCTACCCACCCTCTGG + Intergenic
945181128 2:207092322-207092344 TCACTGCCTCACCCACCCTCTGG - Intronic
945454718 2:210036786-210036808 TCACTTTGTCACCCACCCTGAGG + Intronic
946325546 2:218982943-218982965 TCACTATCCTAGCCACCTTCGGG + Intronic
947106197 2:226670241-226670263 TCAGACTCCCACCCACAGTCAGG + Intergenic
947817415 2:233047573-233047595 TCCCTCTCCCACACTCACTCTGG - Intergenic
948479043 2:238239257-238239279 GCTCTCTCCCTCCCACCCTCGGG - Intronic
948529069 2:238591998-238592020 TCCCTCTCCCCCACAGCCTCTGG + Intergenic
948884032 2:240874183-240874205 GCGCTCTCCCGCCCACCCTCTGG + Intronic
949034862 2:241811709-241811731 TCAGTGTCACACCCACCCTGTGG - Intronic
1168955026 20:1828693-1828715 TCATTCTCCCAGCTTCCCTCTGG - Intergenic
1169334939 20:4748423-4748445 GCACTGTGCCACCCACCCTGGGG + Intergenic
1170793273 20:19525434-19525456 TGGCTCTCCCACAGACCCTCAGG - Intronic
1170838675 20:19906417-19906439 TCACTCTGTCACCCAGGCTCTGG - Intronic
1171811926 20:29751353-29751375 TCTCTCTCTCGCCCACTCTCTGG - Intergenic
1172046566 20:32084573-32084595 TCCCTCTCCCCTCCACCCTCTGG - Intronic
1172099390 20:32476102-32476124 TCACTCTGCCTCCCTCCCACAGG + Intronic
1173338263 20:42130798-42130820 CCACTCTCCCACTCACCCAAAGG - Intronic
1173816915 20:45995430-45995452 GCACCCACCCACCCACGCTCCGG - Intergenic
1174101967 20:48134557-48134579 TCACCCTCCCCCCAAGCCTCTGG - Intergenic
1175032548 20:55970212-55970234 CCTCTCTCCCTCCCTCCCTCTGG + Intergenic
1175199547 20:57267847-57267869 CCACTCTCTCACCCAGCCCCAGG - Intergenic
1175242525 20:57560314-57560336 TCACTCTGCAACCCACCAGCCGG + Intergenic
1175730367 20:61350079-61350101 TGCCTCTCCCACCCAGCGTCAGG + Intronic
1175730387 20:61350156-61350178 TGCCTCTCCCACCCAGCGTCAGG + Intronic
1175730427 20:61350310-61350332 TGCCTCTCCCACCCAGCGTCAGG + Intronic
1175730447 20:61350387-61350409 TGCCTCTCCCACCCAGCGTCAGG + Intronic
1175730467 20:61350464-61350486 TGCCTCTCCCACCCAGCGTCAGG + Intronic
1175730524 20:61350685-61350707 TGCCTCTCCCACCCAGCATCAGG + Intronic
1177418384 21:20824455-20824477 TCCCTCCCACACCCACCCCCAGG - Intergenic
1177822720 21:26049173-26049195 TCCCTCTCCCCCACACCCCCAGG - Intronic
1178176210 21:30102513-30102535 TCAGTCTCCCACTCAACCTCAGG + Intergenic
1179147503 21:38781353-38781375 TCACTCTGTCACCCAGGCTCTGG + Intergenic
1179393248 21:41013175-41013197 TCACACCCCCACACACACTCAGG + Intergenic
1180199352 21:46215398-46215420 TCCCCCTCCCACCCACCCCCAGG + Intronic
1181813224 22:25418072-25418094 TCACTCTGTCACCCAGCCTGGGG + Intergenic
1182008795 22:26983309-26983331 TTAACCTCCCAGCCACCCTCTGG + Intergenic
1182551306 22:31102248-31102270 TCCCTCTCCCTCCCACCCCCAGG - Intronic
1182905687 22:33934208-33934230 TCACTCTCCCAGCCAGGCACCGG - Intergenic
1183143855 22:35971240-35971262 TCACTGTCACACTCACCCTTTGG + Intronic
1183360401 22:37380210-37380232 TCACCCTCTCACCCAGCCTGGGG - Intronic
1183880367 22:40822069-40822091 TCACCCCCCCCCCCACCCCCTGG + Intergenic
1184235292 22:43180028-43180050 TCGCTCACCCATCCACCCACCGG + Intronic
1184556992 22:45238889-45238911 TCTCTCTCTCTCTCACCCTCAGG + Intronic
1184672792 22:46024252-46024274 TCTCCCTCCCAGACACCCTCAGG + Intergenic
1184889698 22:47372205-47372227 ACACAATCCCACACACCCTCAGG + Intergenic
1184897790 22:47422057-47422079 TCTCTCTCCCACCCAGGCTAAGG + Intergenic
1185408521 22:50671266-50671288 TCACACCCCCACCCACCTTCAGG - Intergenic
949250614 3:1979308-1979330 TCCCTCCCCCACCCACCAACAGG - Intergenic
949531801 3:4963042-4963064 TCACTCTGTCACCCAGCCTGGGG - Intergenic
950120586 3:10480064-10480086 TCACTCTGTCACCCAGGCTCTGG - Intronic
950188509 3:10960255-10960277 TCACCCTCCCTGCCAGCCTCAGG + Intergenic
950212063 3:11131015-11131037 TCTCTCCCCCACCATCCCTCTGG + Intergenic
950234661 3:11308185-11308207 TCCCTCTTCCACCCACACTTAGG + Intronic
950538207 3:13594169-13594191 TCAGTATCCTACCCACCCACTGG - Intronic
950632365 3:14291011-14291033 TCACAGTCCACCCCACCCTCTGG + Intergenic
951611188 3:24494596-24494618 TCACCATCCCGCCCACCCTGTGG + Intronic
951986787 3:28629702-28629724 TCACTCTCTCTCTCTCCCTCTGG - Intergenic
953513144 3:43563835-43563857 ACACACACCCACCCAGCCTCTGG - Intronic
953930489 3:47003451-47003473 AGACTCTCCCACTCACCATCTGG - Intronic
954395265 3:50290141-50290163 TAAGTCTCCCACACACCCCCAGG + Intronic
955605745 3:60701416-60701438 TCAGTCTCCCCCCCAAACTCAGG + Intronic
955835223 3:63047299-63047321 ACACCCTCCCACCCTCCCACAGG + Intergenic
959096050 3:101957268-101957290 TGCCTCTCCCAGCCACTCTCTGG + Intergenic
959311556 3:104744088-104744110 TCACTCTATCACCCACGCTGCGG - Intergenic
959831900 3:110874237-110874259 TCTCTCTCTCCCCAACCCTCTGG + Intergenic
961001810 3:123379189-123379211 TCACTCCCCCACCCACATACAGG + Intronic
961313341 3:126017651-126017673 TCACCCTCAGCCCCACCCTCTGG + Intronic
961482550 3:127193367-127193389 GCACTCTCCCACCCAACTCCTGG + Intronic
961704947 3:128777221-128777243 TCACTCTGTCACCCAGCCGCTGG + Intronic
962401257 3:135060944-135060966 TCACTACCCCTCCCAGCCTCTGG + Intronic
962749899 3:138426144-138426166 TCACTCTGTCACCCAGCCTGGGG - Intergenic
962888663 3:139652005-139652027 TCACTGTTCCACCCAGCTTCAGG + Intronic
962929945 3:140026897-140026919 TCACTCTCCCACCTTGGCTCAGG - Intronic
963570032 3:146982173-146982195 GCCCTCTCCCACCCATGCTCTGG + Intergenic
963592134 3:147273940-147273962 TCACTATGCCTCCCAGCCTCTGG - Intergenic
963955720 3:151251463-151251485 TCAATCTGCCTCCCACCCACAGG + Intronic
964162255 3:153659495-153659517 TCACTCTGTCACCCAGGCTCTGG - Intergenic
967387658 3:188927236-188927258 TCACACTCACACCCAGGCTCAGG - Intergenic
967493732 3:190120798-190120820 CCCCTCTCCCACCTTCCCTCGGG + Exonic
967566969 3:190984866-190984888 TCATTCCACCACCCACCATCAGG + Intergenic
968511372 4:997334-997356 GCACTCCCACCCCCACCCTCAGG + Intronic
968697626 4:2040842-2040864 CCACCCTCCCACCCACTCTTAGG + Intronic
969647949 4:8444265-8444287 CCACTCCCCTTCCCACCCTCTGG - Intronic
971011668 4:22444618-22444640 TCACATTCCCACCCACACACAGG + Intronic
971252034 4:24980995-24981017 TGACTCTCCCGCACACTCTCTGG + Intergenic
971925880 4:33009101-33009123 TCACTCTGTCACCCAGCCTGGGG + Intergenic
973807180 4:54537857-54537879 TCACTGTCACACCCACACCCTGG - Intergenic
973844003 4:54892427-54892449 CCACTCTCCCTCCTACCCTTAGG + Intergenic
974004756 4:56544773-56544795 ACAGTCTCCCTCCCGCCCTCGGG - Intronic
974754174 4:66182418-66182440 TTTCACTCCCACCCACTCTCTGG + Intergenic
975364436 4:73512263-73512285 TCACTATTCCTCCCAGCCTCTGG + Intergenic
975797875 4:78028020-78028042 TCACTCTGCCACCCAGGCTAGGG - Intergenic
975835405 4:78417848-78417870 TCACACTCTAACCCACCTTCAGG + Intronic
975920301 4:79379429-79379451 TCACTCTCCTTCCCTGCCTCAGG - Intergenic
976109403 4:81655001-81655023 CCACTCTCCTTCCCAGCCTCTGG + Intronic
977342022 4:95771221-95771243 TCACTACCCCTCCCAGCCTCTGG - Intergenic
978106153 4:104904275-104904297 TCTCGCCCCCACACACCCTCTGG - Intergenic
978834082 4:113126612-113126634 TCTCTCTCCCACCCACACCCAGG - Intronic
980926598 4:139144171-139144193 TCTCTCTCCCTCTCACACTCTGG - Intronic
981638528 4:146909125-146909147 TGACTCTCGCAGCCTCCCTCAGG + Exonic
982720818 4:158857914-158857936 TCACTCTGTCACCCACGCTGGGG - Intronic
982746763 4:159111984-159112006 TCACTCCCCCACCCCACCTCTGG + Intronic
983868768 4:172800100-172800122 TCTCTCTCCCCCCCAGCTTCAGG - Intronic
984496154 4:180499457-180499479 ACACTCTCCCTCCAACCTTCTGG + Intergenic
984703141 4:182831777-182831799 TTACTTTCCCACCCAACCTCTGG + Intergenic
985003259 4:185506187-185506209 TCAGCCTCCCCCCCACACTCTGG - Intronic
985530811 5:433006-433028 TCACTCCCCCACCCGCTCTTTGG - Intronic
985756688 5:1723595-1723617 TCTCCCTCCCACACCCCCTCTGG + Intergenic
985795756 5:1961283-1961305 CCACACTCGCACACACCCTCCGG + Intergenic
986058562 5:4164264-4164286 CCACCCACCCACCCACCCACAGG + Intergenic
986149337 5:5112674-5112696 TCACTCTCCTTCCCAGTCTCTGG + Intergenic
986270719 5:6228410-6228432 TCACTGTCCCCGCCACCCTCTGG + Intergenic
986350812 5:6878047-6878069 TCACGTTCCCAGCCACCCTCAGG + Intergenic
988602241 5:32650535-32650557 TCACTCTGTCACCCACACTGGGG + Intergenic
989686876 5:44099548-44099570 TCACTCTGCCACCCAGGCTGGGG - Intergenic
990423445 5:55660382-55660404 TCACTCTTTCACCCAGGCTCTGG - Intronic
990545498 5:56816519-56816541 TCAGTCTCCCACCCGACCTCGGG - Intronic
990601634 5:57364710-57364732 ACAAACTTCCACCCACCCTCTGG - Intergenic
992303774 5:75412791-75412813 TCACTCACTCACTCACCCTGAGG - Intronic
992396495 5:76373689-76373711 TCACTCTCTCAACCAACCTGTGG - Intergenic
992921491 5:81527046-81527068 TCACTCCCCTCCCCACCCTATGG - Intronic
993343730 5:86756599-86756621 TCCTTCTCCCACCCACCTTATGG + Intergenic
993554901 5:89324234-89324256 TCCCTCTCCCAACAAGCCTCTGG + Intergenic
994396877 5:99232775-99232797 TCAGGCTCTCACCCACCCCCTGG + Intergenic
994397148 5:99234441-99234463 TCAGGCTCTCACCCACCCCCTGG - Intergenic
994575569 5:101574881-101574903 TCACTCTGTCACCCAGGCTCGGG + Intergenic
995700902 5:114934001-114934023 CCAGCCTCCCACCCACCGTCTGG - Intergenic
996366560 5:122707668-122707690 TCACTCTGTCACCCAGGCTCAGG + Intergenic
997264067 5:132484715-132484737 CCCCTCTCACACCCACTCTCTGG + Intronic
997419008 5:133751107-133751129 TCCCTCTCCCCCCAGCCCTCAGG + Intergenic
997532865 5:134593018-134593040 TCACTCTGCCACCCAGGCTGGGG - Intergenic
997654081 5:135542715-135542737 ACACATTCCCACCCACCCCCCGG + Intergenic
999280493 5:150362093-150362115 TTCCTCTCCCACCCATCCACAGG - Intronic
999418666 5:151421618-151421640 TCACTCTGTCACCCAGGCTCTGG + Intergenic
999606699 5:153324442-153324464 TCACTCTCCCATCCCCTCACTGG + Intergenic
999786277 5:154893385-154893407 TCACTCTGTCACCCAGGCTCGGG - Intronic
999849830 5:155525864-155525886 TCACTCTGTCACCCAGCCTGGGG - Intergenic
1001903594 5:175452465-175452487 TCACTCTCACCCCCAGCTTCAGG + Intergenic
1002259134 5:177982144-177982166 CCACTCTCCCTCCCACCCCCAGG + Intergenic
1002593766 5:180308899-180308921 TCACTCTGTCACCCAACCTGGGG + Intronic
1003026393 6:2559008-2559030 TCCCTCTACCACCCACGCACTGG - Intergenic
1003082046 6:3028647-3028669 TAACTGTCACACCCACCCTAAGG + Intergenic
1003267274 6:4576896-4576918 TCACTCTGTCACCCAACCTGGGG + Intergenic
1003418162 6:5931767-5931789 TCCCTCTCCTGCCCACCTTCTGG + Intergenic
1003508340 6:6758632-6758654 ACTCTCTCCCACCCTCACTCAGG - Intergenic
1004838710 6:19558049-19558071 TCACCCCCCCTCCCACCTTCTGG - Intergenic
1005735317 6:28740302-28740324 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1006034846 6:31202978-31203000 CCATTCTCCCTCCCACCCCCTGG - Exonic
1006084931 6:31588895-31588917 TCACCCTTCCACCCACTCTGGGG + Exonic
1006108257 6:31729380-31729402 TCACTCTACCCAGCACCCTCAGG + Exonic
1006416878 6:33909717-33909739 GGCCACTCCCACCCACCCTCGGG - Intergenic
1006721015 6:36151308-36151330 TCACTCTGCCACCCAGGCTGGGG + Intergenic
1006771270 6:36554777-36554799 TGACTCTCCCATCCACCCTGTGG - Intergenic
1006916528 6:37597703-37597725 TCACTCACCCTCCGAGCCTCAGG - Intergenic
1008363452 6:50648789-50648811 TCACTCTCCCACTTACCATGAGG - Intergenic
1008369626 6:50717421-50717443 TCACTTTCCCTCCCACTCTCTGG - Intronic
1008591638 6:52999276-52999298 TCACTCCCCCACCCCCCGACTGG - Intergenic
1009000488 6:57707064-57707086 CCACTCTCCCGTCCACCCACCGG + Intergenic
1009588020 6:65631214-65631236 TCATTCTCCAGCCCACCTTCTGG + Intronic
1010249481 6:73693370-73693392 TCACTCACCCCCCGACCCCCAGG + Intergenic
1010809914 6:80289664-80289686 TCACTCTCACCGCCAGCCTCTGG + Intronic
1011217950 6:85025247-85025269 TCACTCTCTCCCCCTCCCACAGG + Intergenic
1011770401 6:90669551-90669573 CCACCCTCACACCCACCCACTGG - Intergenic
1012971076 6:105731818-105731840 GCAGTCTCCCTCCCACCCCCTGG + Intergenic
1013933741 6:115568536-115568558 CCCCTCTCCCACCCTCCCCCCGG - Intergenic
1014991851 6:128089719-128089741 TCACTCTCCTTCCTTCCCTCTGG + Exonic
1015366522 6:132402134-132402156 TCTCTCACCCTCCCACCCTGCGG + Intergenic
1016456876 6:144240080-144240102 TCACTATCCTTCCCAGCCTCTGG + Intergenic
1016857218 6:148683313-148683335 TCACTCTCCCCCTAACCCTTTGG + Intergenic
1017761705 6:157574389-157574411 TCACTCTGTCACCCAGCCTGGGG - Intronic
1018065934 6:160125112-160125134 TCACCCTCCCACCTACCCCCAGG - Intronic
1018608078 6:165620268-165620290 TCTCTCTCCCACCCCCACCCTGG + Intronic
1019653534 7:2173828-2173850 TCACTCTGCCACCCAGGCTGGGG + Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1019681614 7:2353716-2353738 CCACTCTCCACCCCAGCCTCTGG + Intronic
1019712941 7:2525616-2525638 TCACGGTCCCACCCCCACTCCGG - Intronic
1020066946 7:5195452-5195474 TCACTCTGCCACCCAGGCTGGGG - Intronic
1020116854 7:5481030-5481052 TCCCCCTCCCACCCACCCCACGG - Exonic
1020262881 7:6540550-6540572 TCACTCTGCCACCCAGGCTGGGG + Intronic
1022232655 7:28429055-28429077 TCACTCTGCCACCCAGGCTAGGG + Intronic
1022267505 7:28771785-28771807 CCACCCTCCCACCCACCCACGGG - Intronic
1022517864 7:30987266-30987288 TCCCTCTCCTGCCCACCCCCAGG - Intronic
1022929919 7:35100550-35100572 TCACTATCCTTCCCAGCCTCTGG - Intergenic
1023740315 7:43274630-43274652 TCTCTCTCCCTCCCTCCCCCGGG - Intronic
1023861395 7:44219558-44219580 CCCCTCTCCCATCCACCCCCAGG + Intronic
1024201541 7:47113644-47113666 TTTCTCTCCCACTCTCCCTCTGG + Intergenic
1024776057 7:52787476-52787498 TCCCTATCCCAGCCACCCACAGG - Intergenic
1025268640 7:57488590-57488612 TCACTCTGTCACCCATCCTGGGG - Intergenic
1025298076 7:57792619-57792641 TCACTCTGTCACCCACACTGGGG - Intergenic
1026059090 7:67010343-67010365 TCACTCTCTCACCCAGGCTCTGG + Intronic
1026719005 7:72814714-72814736 TCATTCTCTCACCCAGGCTCTGG - Intronic
1028949076 7:96613701-96613723 TTCCACTCCCACCCAGCCTCTGG + Intronic
1029580419 7:101433482-101433504 TCTCTGTTCCACCCTCCCTCTGG - Intronic
1029825813 7:103192994-103193016 TCACTATCCTTCCCAGCCTCTGG - Intergenic
1030152377 7:106420352-106420374 CCACACTCACACCCACCCACAGG - Intergenic
1030920397 7:115377676-115377698 TCACTCTGTCACCCAGCCTGGGG + Intergenic
1031088332 7:117324339-117324361 CCTCTCTCCAGCCCACCCTCGGG + Intergenic
1031965781 7:128027307-128027329 TCCCTCTCCCAGGCCCCCTCAGG - Exonic
1032666343 7:134040455-134040477 TCGCACTCCCACCCCTCCTCTGG + Intronic
1034002961 7:147436804-147436826 TTAGGCTCCCACCCACACTCAGG + Intronic
1034480036 7:151312631-151312653 TCACACTCACACACACCCTGTGG - Intergenic
1035231233 7:157467254-157467276 TCAATCTGCCAGCCACCCTATGG - Intergenic
1035530840 8:349807-349829 TCCCTGTCCCATCCAGCCTCAGG - Intergenic
1036378522 8:8220877-8220899 TCACTCCACCACCCACCTCCCGG + Intergenic
1037786527 8:21906518-21906540 TAGCTCTCCCACCCAGCTTCAGG + Intergenic
1037788493 8:21917339-21917361 TCACTCTACCATGCCCCCTCTGG - Intergenic
1037973557 8:23192322-23192344 CCACTCTCCCTCCCTCCCTCGGG - Intronic
1039411967 8:37362414-37362436 AAACTCACCCTCCCACCCTCTGG - Intergenic
1039444597 8:37621129-37621151 CCTCTGTCCCACCCACCCACTGG - Intergenic
1039919897 8:41886159-41886181 TCTCTCTGCCACCCACCCCTAGG + Intronic
1042065871 8:64875228-64875250 TCACTCCACCCCCCAGCCTCTGG + Intergenic
1042068366 8:64903441-64903463 TCACTCCCCCACTAACCCTCTGG - Intergenic
1043638981 8:82424995-82425017 TCACTCTGTCACCCAGGCTCTGG - Intergenic
1044212054 8:89561674-89561696 TCACTCCCTCACCTTCCCTCTGG + Intergenic
1044554014 8:93542459-93542481 TCACTCTCTCATCCTCCCCCCGG - Intergenic
1045371809 8:101531807-101531829 TCTCTCCCCCACCCCCTCTCGGG - Intronic
1046419719 8:113964379-113964401 TCCTTCTCCTACCCAGCCTCTGG + Intergenic
1046856037 8:119032868-119032890 TCACTCTGCCGCCCAGGCTCCGG - Intronic
1047300517 8:123609766-123609788 TCCCGATCCCACCCACCCTGTGG - Intergenic
1047417088 8:124673524-124673546 TCACTCTTCCACCTCCCCTGGGG - Intronic
1047615226 8:126557821-126557843 TAACTTCCCCTCCCACCCTCGGG + Intronic
1047667818 8:127111491-127111513 CCCCTCTCCACCCCACCCTCTGG - Intergenic
1047873652 8:129111992-129112014 TCTCTCTCCTTCTCACCCTCAGG - Intergenic
1048176521 8:132157526-132157548 ACACTCTCCCAGCCAGCCACTGG - Intronic
1048510172 8:135054956-135054978 TCACTCTGGCATTCACCCTCTGG - Intergenic
1049270720 8:141694444-141694466 CATCTCTCCCACACACCCTCAGG + Intergenic
1049690070 8:143954423-143954445 TGCCTCTCCCACCCAGCCTCAGG + Intronic
1049766977 8:144359417-144359439 CCTCCCTCCCACTCACCCTCTGG - Exonic
1049949171 9:627707-627729 GCACTCTCCCATCCACCCTCTGG - Intronic
1050130131 9:2403417-2403439 TCACTCTGTCACCCACACTGGGG + Intergenic
1052749843 9:32478589-32478611 TCACTCTACCACCCAAGCTGGGG + Intronic
1052940799 9:34130624-34130646 TCATTCTCCCACCCAGGCTGGGG + Intergenic
1053159844 9:35806314-35806336 TTCCTATCCAACCCACCCTCTGG - Intronic
1053394751 9:37763110-37763132 TCACTCTGTCACCCAGGCTCTGG - Intronic
1053655567 9:40215521-40215543 TCACTCTGTCACCCAGGCTCAGG + Intergenic
1053795526 9:41723418-41723440 TCACTCTGTCACCCACACTGGGG + Intergenic
1054149657 9:61591458-61591480 TCACTCTGTCACCCACACTGGGG - Intergenic
1054183936 9:61935473-61935495 TCACTCTGTCACCCACACTGGGG + Intergenic
1054367685 9:64361751-64361773 TCACTCTGTCACCCAGGCTCAGG + Intergenic
1054469421 9:65522568-65522590 TCACTCTGTCACCCACACTGGGG - Intergenic
1054529039 9:66160771-66160793 TCACTCTGTCACCCAGGCTCAGG - Intergenic
1054654569 9:67653013-67653035 TCACTCTGTCACCCACACTGGGG - Intergenic
1054675302 9:67851486-67851508 TCACTCTGTCACCCAGGCTCAGG + Intergenic
1054911924 9:70462867-70462889 TCAATCTATCACCCACCCTCAGG - Intergenic
1056708317 9:88970103-88970125 TCACCCTCCCCCACACCCCCAGG + Intergenic
1057276592 9:93679271-93679293 CCCCTCTCCCACCCAGTCTCGGG - Exonic
1057366371 9:94425270-94425292 TCACTCTGTCACCCAGGCTCAGG - Intronic
1058398226 9:104581129-104581151 TCACTCTGTCACCCAGCCACGGG + Intergenic
1058859677 9:109103723-109103745 TCACTATCCTTCCCAGCCTCTGG - Intronic
1060497637 9:124130108-124130130 TCCCTCTCCCTCCCTCTCTCTGG + Intergenic
1060512362 9:124243189-124243211 TCACTCTCCCCCTCACCGTCTGG - Intergenic
1061178399 9:129010560-129010582 TCACTCTGCCCCACACCCACTGG - Intronic
1061443139 9:130620588-130620610 CCACCCTCACACCCACCCTAAGG - Intronic
1061536814 9:131255412-131255434 TCACTCTGTCACCCAGGCTCTGG + Intergenic
1062288758 9:135785411-135785433 CCACCCACCCACCCACCCACAGG + Intronic
1062665385 9:137668329-137668351 CCACTCACCCACCCACCACCTGG + Intronic
1185830841 X:3301559-3301581 TCACTCTGCAACTCACTCTCTGG + Intergenic
1187246325 X:17555774-17555796 TCCCTCCTCCACCCACCCCCAGG + Intronic
1187678168 X:21738865-21738887 CCTCTCTCCCTCCCAGCCTCGGG + Intronic
1187686118 X:21817442-21817464 TCCCACTCCCACTCACCCTGGGG - Intergenic
1188580427 X:31705237-31705259 TCCATCTACCACCCACCATCAGG - Intronic
1188971688 X:36625165-36625187 TCACTACCCTTCCCACCCTCTGG + Intergenic
1189202667 X:39210967-39210989 TAACACCCCCACACACCCTCAGG - Intergenic
1189847101 X:45148071-45148093 ACCCTCCCCCACCCACCCTGTGG - Intergenic
1190488650 X:50957777-50957799 CCAATCTCCCACCCACCAACAGG - Intergenic
1190618413 X:52262107-52262129 ACACTCTCCCAGCCAGCCCCTGG + Intergenic
1191037109 X:56037978-56038000 TCACTATCCAACCCAGCCTCTGG + Intergenic
1191869781 X:65736237-65736259 TAGCTCTCCCACCAACCCACTGG - Intronic
1193725078 X:85028687-85028709 TCACTATCCTTCCCAGCCTCTGG + Intronic
1193931067 X:87552795-87552817 TCACTATCCTTCCCAGCCTCTGG - Intronic
1194309577 X:92287934-92287956 TCACTCTCTCTCCCTCCTTCTGG + Intronic
1195435237 X:104836252-104836274 CCACTATCCTACCCAGCCTCTGG - Intronic
1195665901 X:107430003-107430025 TCACTCTGTCACCCAGGCTCTGG - Intergenic
1196891962 X:120299965-120299987 TGACTCTCCTACCCACTCCCTGG + Intronic
1196894541 X:120321989-120322011 TCAGCCTCCCTCCCACCCCCAGG + Intergenic
1196937543 X:120744502-120744524 CCACTCTCCTTCCCATCCTCTGG + Intergenic
1198087501 X:133294567-133294589 TTACTCTTCAACCCACCCTTTGG - Intergenic
1198482327 X:137052486-137052508 TCGCTCTTACTCCCACCCTCTGG + Intergenic
1199512696 X:148640383-148640405 TCTCCCTCCCTCCCTCCCTCTGG + Intronic
1199609509 X:149600788-149600810 CCACTCTCCCACACTCTCTCAGG + Intronic
1199629607 X:149768566-149768588 CCACTCTCCCACACTCTCTCAGG - Intergenic
1200398912 X:156007368-156007390 TCACATTCCAACCCACTCTCAGG - Intronic
1202603400 Y:26617846-26617868 TCACTCTGCCACCCAGGCTGGGG - Intergenic