ID: 1142685901

View in Genome Browser
Species Human (GRCh38)
Location 17:1576791-1576813
Sequence TGGCACCAACGGTGCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142685901_1142685908 -10 Left 1142685901 17:1576791-1576813 CCCGGGCTGCACCGTTGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1142685908 17:1576804-1576826 GTTGGTGCCAGAGAAGGGTGGGG 0: 1
1: 0
2: 3
3: 23
4: 342
1142685901_1142685912 18 Left 1142685901 17:1576791-1576813 CCCGGGCTGCACCGTTGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1142685912 17:1576832-1576854 GCCCTCGGATTCCTTCCTGCTGG 0: 1
1: 0
2: 3
3: 15
4: 146
1142685901_1142685910 3 Left 1142685901 17:1576791-1576813 CCCGGGCTGCACCGTTGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1142685910 17:1576817-1576839 AAGGGTGGGGTGCCAGCCCTCGG 0: 1
1: 0
2: 1
3: 22
4: 212
1142685901_1142685914 19 Left 1142685901 17:1576791-1576813 CCCGGGCTGCACCGTTGGTGCCA 0: 1
1: 0
2: 2
3: 8
4: 142
Right 1142685914 17:1576833-1576855 CCCTCGGATTCCTTCCTGCTGGG 0: 1
1: 1
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142685901 Original CRISPR TGGCACCAACGGTGCAGCCC GGG (reversed) Intronic
900129661 1:1082007-1082029 TGAGACCCACGGTGGAGCCCGGG + Exonic
900866863 1:5275162-5275184 CGCCACCTGCGGTGCAGCCCTGG + Intergenic
901636953 1:10674926-10674948 TGGCAGCAGGGGAGCAGCCCTGG + Intronic
902090436 1:13898643-13898665 TGGCATCAGAGCTGCAGCCCAGG - Intergenic
902212088 1:14911628-14911650 TGGCACTGATGGTGCAGCTCTGG + Intronic
915308427 1:154994361-154994383 TGGGAGCAAGGGTGCAGACCAGG + Intergenic
916247987 1:162707538-162707560 TTGCACCAACCCTGCAGCCATGG + Intronic
916656118 1:166876506-166876528 TGTCAGCAACGTTGCAGCCGAGG - Intergenic
920955051 1:210611825-210611847 TGGAACCAACTTTGCATCCCAGG + Intronic
921460239 1:215416499-215416521 AGGCACCAGCTGTGTAGCCCTGG - Intergenic
921462744 1:215448145-215448167 AGGCACCAGCTGTGTAGCCCTGG + Intergenic
923656880 1:235924523-235924545 TGGCACAAACGGTCCAGGGCAGG + Intergenic
1062995477 10:1862295-1862317 TGGCATCACAGGTGCAGTCCAGG - Intergenic
1064028766 10:11869872-11869894 CGTCACCAACGGCGCGGCCCGGG + Exonic
1066659658 10:37727678-37727700 TGCCGCCAGCAGTGCAGCCCGGG - Intergenic
1067935045 10:50603323-50603345 TGTTACCCACGGTTCAGCCCTGG - Intronic
1067935123 10:50604297-50604319 TTTCACCGACGGTTCAGCCCTGG - Intronic
1071255462 10:83868186-83868208 TGGCACCACAGGTGAAGCCAAGG + Intergenic
1071827403 10:89338847-89338869 TGGTAACAACGAGGCAGCCCTGG + Exonic
1072862113 10:99017344-99017366 TTGCACCAACCTTGCATCCCAGG + Intronic
1073156832 10:101354128-101354150 TGGCACCAAAGGGGCGGCCCCGG + Exonic
1075062778 10:119268383-119268405 TGAAACCAACGGGGCTGCCCAGG - Intronic
1075780985 10:125016982-125017004 TGGCACCAACTGCCCAGCGCAGG - Intronic
1076294472 10:129373974-129373996 TGCCACCAACCCTCCAGCCCTGG - Intergenic
1077066429 11:642949-642971 CAGCACCAACGGTGCAGCACCGG + Intergenic
1077110739 11:860940-860962 GGGCACCCACGCTGCAGACCGGG + Intronic
1077251652 11:1563433-1563455 TGGCACCAAGGCTGCTGCCTGGG - Intronic
1081691360 11:45080665-45080687 TGGCACAAACTGTGAATCCCTGG + Intergenic
1081693232 11:45092367-45092389 TGGGACCAGCAGAGCAGCCCTGG - Intergenic
1082814901 11:57501231-57501253 AGGAACCAATGGTGAAGCCCAGG + Exonic
1083212706 11:61198639-61198661 TGGCAGCCACGGATCAGCCCTGG + Intergenic
1083215651 11:61217802-61217824 TGGCAGCCACGGATCAGCCCTGG + Intergenic
1083218535 11:61236631-61236653 TGGCAGCCACGGATCAGCCCTGG + Intergenic
1083723119 11:64613371-64613393 GAGCACCAGCGGTGCACCCCAGG + Intronic
1085047493 11:73362214-73362236 TGGCAGCGAGGCTGCAGCCCGGG - Exonic
1086247668 11:84773594-84773616 TGGAACCAACTTTGCATCCCAGG - Intronic
1092365575 12:7873793-7873815 TGGCACCAATGGGGCAGCAGGGG - Intronic
1092383733 12:8019342-8019364 TGGCACCAACGGGGCAGCAGGGG - Intergenic
1097703284 12:62842077-62842099 TGGCTCCAACAGAGCAGCACTGG - Intronic
1098327759 12:69320335-69320357 TTGAACCAACCGTGCATCCCAGG + Intergenic
1105242178 13:18618812-18618834 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1105306446 13:19172404-19172426 TGGCACCATCAGGGCAGACCAGG + Intergenic
1105711765 13:23016864-23016886 TGGAACCAACTTTGCATCCCAGG + Intergenic
1110614084 13:77521797-77521819 TGGCATTCACAGTGCAGCCCAGG - Intergenic
1111432216 13:88159394-88159416 TGACACCATAGGTGCAGGCCGGG + Intergenic
1119260876 14:73237541-73237563 GGGCACCGACGGAGCGGCCCTGG + Exonic
1119907581 14:78319678-78319700 TGGCACTGAGGCTGCAGCCCTGG + Intronic
1122122114 14:99560250-99560272 GGGCACCAACGCTGCAGCCAGGG + Intronic
1122370337 14:101225919-101225941 GGGCAGCAGCTGTGCAGCCCTGG - Intergenic
1123458679 15:20448070-20448092 TGTCACCAAGGCTGGAGCCCAGG + Intergenic
1123489137 15:20765785-20765807 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1123545636 15:21334872-21334894 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1129039786 15:72676098-72676120 TGGCTGCAATGGTGAAGCCCTGG + Exonic
1129241052 15:74252517-74252539 TGGTTCTAACGGTGCAGTCCTGG + Intronic
1131013443 15:89038518-89038540 TGGCCCCACTGCTGCAGCCCTGG + Intergenic
1131746745 15:95456796-95456818 TGGGACAAACAGTGCTGCCCAGG + Intergenic
1202953978 15_KI270727v1_random:62142-62164 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1132602406 16:779553-779575 TGGCACCTGCTGGGCAGCCCCGG + Intronic
1133065870 16:3206754-3206776 GTGCACCACCTGTGCAGCCCGGG + Intergenic
1133369741 16:5238800-5238822 TGACACTAACGGTGCATCCTGGG + Intergenic
1136772825 16:32856974-32856996 TGTGACCTAAGGTGCAGCCCTGG - Intergenic
1136897789 16:34004545-34004567 TGTGACCTAAGGTGCAGCCCTGG + Intergenic
1138532109 16:57640032-57640054 TGACACCGGGGGTGCAGCCCAGG - Intronic
1203075249 16_KI270728v1_random:1119084-1119106 TGTGACCTAAGGTGCAGCCCTGG - Intergenic
1142604924 17:1076324-1076346 CGGCACTGAGGGTGCAGCCCAGG + Intronic
1142682788 17:1560349-1560371 TGGCCGCAGCGTTGCAGCCCTGG - Intronic
1142685901 17:1576791-1576813 TGGCACCAACGGTGCAGCCCGGG - Intronic
1145866899 17:28247523-28247545 TGGCTCCAACGGGGCTCCCCGGG - Intergenic
1147849870 17:43433776-43433798 TGGCAGCAACAGTGCAGAGCTGG - Intergenic
1148455307 17:47808167-47808189 TGAGACCAAAGGGGCAGCCCTGG - Exonic
1148741329 17:49894790-49894812 TGTCACCAAGGGTGGGGCCCAGG - Intergenic
1150211914 17:63446393-63446415 TGGCACGTGCGGGGCAGCCCCGG - Intergenic
1151855129 17:76715641-76715663 TGCCTCCAACGCTCCAGCCCAGG + Exonic
1154411462 18:14144303-14144325 TAGAACCAAGGGTGCAGACCTGG + Intergenic
1154446772 18:14441068-14441090 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1160981433 19:1818340-1818362 TGCCAAAGACGGTGCAGCCCAGG + Intronic
1161686303 19:5704322-5704344 TGGCACCGTCGGAGCAGCCATGG + Intronic
1165266174 19:34665027-34665049 TGGCCCCAAGGCTGCAGCACGGG + Intronic
1167498096 19:49830853-49830875 TGGCTCCCACGGCACAGCCCGGG + Exonic
1167980497 19:53271024-53271046 TGGCAACGACAGTGCAGCCTTGG + Intergenic
1167985680 19:53313192-53313214 TGGCAACGACAGTGCAGCCTTGG - Intergenic
1168494950 19:56840318-56840340 CGGCACCAACGCAGCAGCCCGGG + Intronic
926142679 2:10377647-10377669 TGGCACCTCCTGAGCAGCCCTGG + Intronic
930485436 2:52006678-52006700 TGCCACCAAAGTGGCAGCCCAGG - Intergenic
936066003 2:109332619-109332641 TTCCACCCACGGGGCAGCCCTGG - Intronic
937320849 2:120959862-120959884 TGGCGCCAGCAGTGCAGCTCAGG + Intronic
938030340 2:127986834-127986856 TAGCACCAACGCTCCCGCCCAGG - Exonic
939947996 2:148433669-148433691 TGGAACCAACCTTGCATCCCAGG + Intronic
943057282 2:182998000-182998022 TGGAACCAACCTTGCATCCCAGG - Intronic
944392513 2:199231569-199231591 TGGTACCAACCTTGCACCCCAGG + Intergenic
944799088 2:203219106-203219128 TGGCACCACGGGTGAAGCACTGG - Exonic
948366923 2:237461838-237461860 TGGAACCAGCGTTGCATCCCAGG - Intergenic
948415315 2:237798760-237798782 TGGCGCCACCGGAGCAGCCGCGG - Exonic
948879958 2:240851569-240851591 TGGCCCCAACGCGGCAGCTCAGG - Intergenic
1174454567 20:50640159-50640181 TGACACCTACGGAGCGGCCCTGG + Intronic
1175206709 20:57316948-57316970 TTGGACAAACGGAGCAGCCCTGG - Intergenic
1176449202 21:6848772-6848794 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1176827370 21:13713796-13713818 TGGCAGCAGCTGTGCAGCTCTGG - Intergenic
1178854586 21:36239789-36239811 TGGCACCATCCGTGCAGGCCAGG - Exonic
1179569899 21:42272617-42272639 TGGGAGCATCAGTGCAGCCCGGG - Intronic
1183475680 22:38034591-38034613 TGACACCAGCCGTGCAGCCCTGG + Intronic
1184240884 22:43210735-43210757 TGGCACCAAAGGGGCAGCCCTGG - Intronic
1185249285 22:49791293-49791315 CGGGGCCAACAGTGCAGCCCAGG + Intronic
950087456 3:10270382-10270404 CAGCAGCAACGATGCAGCCCAGG + Exonic
950676024 3:14555022-14555044 TGGCAGCAAAGGTGAAGCCTGGG + Intergenic
955886407 3:63603663-63603685 TAGCACCAACCTTGCATCCCAGG + Intronic
965112495 3:164445865-164445887 TTGAACCAACGTTGCATCCCAGG + Intergenic
968165792 3:196464241-196464263 TGGCACCACTGCTCCAGCCCGGG - Intergenic
968899101 4:3422522-3422544 TGGCATCAACGGGGCGGCCGCGG + Exonic
978299003 4:107243628-107243650 TGGCACCAGCTGTGCAGCCCTGG - Intronic
978696435 4:111585371-111585393 TGGTACCAAGGGTGAAGCACTGG - Intergenic
984396762 4:179211578-179211600 TGGATCCAAAGGTGCAGTCCAGG + Intergenic
985168444 4:187122920-187122942 TGGCAGCAACTCTGCAGCACAGG - Intergenic
989820480 5:45789948-45789970 TTGAACCAACGTTGCATCCCAGG - Intergenic
991371080 5:65920614-65920636 TGGCACAATCGCTGGAGCCCAGG + Intergenic
991507964 5:67344088-67344110 TGGGAACAAGGGTGTAGCCCTGG - Intergenic
993734720 5:91462799-91462821 TTGAACCAACCTTGCAGCCCAGG - Intergenic
1002072530 5:176688609-176688631 TGTCCCCACCTGTGCAGCCCTGG + Intergenic
1002757954 6:179494-179516 GGGCTCCCACGGTGCAGCGCTGG - Intergenic
1004234159 6:13859915-13859937 GGGCACCCACGGTGCAGCGGCGG - Intergenic
1007314511 6:40975575-40975597 TTGCACCAACCTTGCATCCCAGG + Intergenic
1007444647 6:41895437-41895459 TTGCGCCAACGGCGCAGCGCTGG + Intergenic
1007910044 6:45504429-45504451 TGGCACTAACTGTGCAGGCTTGG - Intronic
1012544971 6:100408729-100408751 TGGAACCAACCTTGCATCCCAGG + Intronic
1018464836 6:164034389-164034411 TTGAACCAACGTTGCATCCCAGG + Intergenic
1019288304 7:234611-234633 CGGCACCATCGGGGCATCCCCGG + Intronic
1020784500 7:12556597-12556619 TGGCTCCCACAGTGCAGCCGTGG + Intergenic
1022516324 7:30977062-30977084 TGGGGCCAACAGTACAGCCCTGG + Intronic
1023549596 7:41355322-41355344 TCTCCCCAAAGGTGCAGCCCAGG - Intergenic
1024620474 7:51152864-51152886 ATGCTCCAACGGTTCAGCCCAGG + Intronic
1027211222 7:76150362-76150384 TGGCACCACTGGCGCAGCCACGG - Intergenic
1028496162 7:91463421-91463443 TGCCAGCAACCGTGAAGCCCAGG - Intergenic
1034350819 7:150413701-150413723 TGACACCAACGCTGCTGGCCCGG - Intergenic
1034400084 7:150856479-150856501 TGGCAGCCACGGCCCAGCCCAGG - Exonic
1035159857 7:156942806-156942828 GAGCACCAGCGGTGCAACCCCGG + Intergenic
1035295075 7:157862609-157862631 TGGAACCACCGGTGCAGGCTTGG + Intronic
1036378199 8:8218773-8218795 TGCCACCAACGTGGGAGCCCAGG - Intergenic
1036762293 8:11517761-11517783 CAGCACCCATGGTGCAGCCCTGG + Intronic
1036793117 8:11736535-11736557 TGGCAGGAACTCTGCAGCCCAGG + Intronic
1042777956 8:72455632-72455654 TGGAACCAATGGTGTATCCCAGG + Intergenic
1042794232 8:72643111-72643133 AGGCACCCACTGTGCAGACCTGG - Intronic
1042976372 8:74474612-74474634 TTGCACCAACCTTGCATCCCAGG + Intronic
1044417556 8:91953512-91953534 TTGCTCCAACAGTGCAGACCTGG - Intergenic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1061926459 9:133808315-133808337 TGGGCCCAAGGGGGCAGCCCAGG + Intronic
1062430145 9:136523278-136523300 TAGCACCTAAGGTGGAGCCCAGG - Intronic
1203519986 Un_GL000213v1:35744-35766 TGGCAGCAGCTGTGCAGCTCTGG + Intergenic
1188723214 X:33548591-33548613 TGGAACCAACCTTGCATCCCGGG + Intergenic
1194714182 X:97271605-97271627 TGGTACCAAAGGAGCACCCCAGG - Intronic
1194800677 X:98268638-98268660 TTGAACCAACCGTGCATCCCTGG - Intergenic
1194854188 X:98908307-98908329 TTGAACCAACCGTGCATCCCGGG + Intergenic
1196893176 X:120309616-120309638 TGGCGCCAACAACGCAGCCCTGG - Intronic
1198083985 X:133265707-133265729 TGGCACCTCCAGTGCAGCCCGGG - Intergenic