ID: 1142687825

View in Genome Browser
Species Human (GRCh38)
Location 17:1587884-1587906
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 2, 1: 0, 2: 3, 3: 51, 4: 505}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142687825_1142687828 -9 Left 1142687825 17:1587884-1587906 CCAGCCACAGCCTCTGTACCCTG 0: 2
1: 0
2: 3
3: 51
4: 505
Right 1142687828 17:1587898-1587920 TGTACCCTGCTCCCATTTTCAGG 0: 1
1: 1
2: 0
3: 11
4: 165
1142687825_1142687835 20 Left 1142687825 17:1587884-1587906 CCAGCCACAGCCTCTGTACCCTG 0: 2
1: 0
2: 3
3: 51
4: 505
Right 1142687835 17:1587927-1587949 TCCCCAAGCACTGTTGGCCCTGG 0: 2
1: 0
2: 0
3: 19
4: 138
1142687825_1142687834 14 Left 1142687825 17:1587884-1587906 CCAGCCACAGCCTCTGTACCCTG 0: 2
1: 0
2: 3
3: 51
4: 505
Right 1142687834 17:1587921-1587943 CCTCAATCCCCAAGCACTGTTGG 0: 2
1: 0
2: 0
3: 19
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142687825 Original CRISPR CAGGGTACAGAGGCTGTGGC TGG (reversed) Intronic
900094095 1:933406-933428 CTGGGTGGAGGGGCTGTGGCTGG - Intronic
900308148 1:2020930-2020952 GTGGACACAGAGGCTGTGGCTGG - Intronic
900981654 1:6049300-6049322 CAGGGGGCAGTGGCAGTGGCAGG + Intronic
901496984 1:9627882-9627904 CAGGGAACAGAGGCCGCGGGTGG + Intergenic
901828869 1:11880054-11880076 CAGGGTGCTGGTGCTGTGGCGGG - Intergenic
902103936 1:14017627-14017649 CAGGCTGCAGAGGCTCTGTCGGG + Intergenic
902411144 1:16212290-16212312 AAGGGCAGAGAGGCTCTGGCAGG - Intronic
902655832 1:17867482-17867504 CAGAGCACTGAGGGTGTGGCAGG + Intergenic
902877922 1:19352113-19352135 CAGGGAACAGAGGGTGGGCCGGG - Intronic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903070295 1:20723821-20723843 CAGGGTAGAGAGGCTTGGGGAGG - Intronic
904287830 1:29463515-29463537 CAGGGGGTAGGGGCTGTGGCTGG - Intergenic
904332366 1:29768483-29768505 CAGGGAGAAGAGGCTGAGGCAGG + Intergenic
904405768 1:30287010-30287032 CACAGTATAGAGGCTGGGGCAGG + Intergenic
904912982 1:33949327-33949349 CCGGGTACAGTGGCTGGGGAGGG + Intronic
905263358 1:36734471-36734493 AAGGGTACAGGGGCTGGGGGAGG - Intergenic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
906239135 1:44230731-44230753 CAGGATATAGAGGTTGTGGCAGG - Intronic
906487809 1:46245298-46245320 CAGGGAACAGAGTTTGAGGCAGG - Intergenic
907046839 1:51304851-51304873 CAGGGTGCAGAGGCTCTGGGTGG - Intronic
907797186 1:57729401-57729423 CAGTGCAGAGAGGATGTGGCGGG - Intronic
911129910 1:94377240-94377262 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
911743235 1:101410776-101410798 CACAGCACAGAAGCTGTGGCAGG + Intergenic
912274281 1:108240224-108240246 CAGGATACAGAGCCTGTGCGTGG - Intronic
912286986 1:108379638-108379660 CAGGATACAGAGCCTGTGCGTGG + Intronic
912293938 1:108454099-108454121 CAGGATACAGAGCCTGTGCGTGG + Intronic
912522355 1:110254312-110254334 CAGGGGTCAGATCCTGTGGCTGG - Intronic
916502825 1:165401234-165401256 CTGGGTGGGGAGGCTGTGGCTGG + Exonic
916757213 1:167783998-167784020 CAGGCTACAGAGACTGTGAAAGG + Intronic
916939384 1:169663589-169663611 CAGGGTCCAGGGACTGTTGCGGG + Intronic
916939396 1:169663669-169663691 CAGGGTCCAGGGACTGTTGCAGG + Intronic
916942943 1:169695151-169695173 CAAAGCACAGAGGCTATGGCAGG - Intronic
917804121 1:178598175-178598197 CTGGGTGCAGAGGGTGTGGCTGG - Intergenic
919755183 1:201062143-201062165 CAGGGCCCAGAGGATGTGGGTGG - Intronic
923146082 1:231199201-231199223 CTGGGTGCAGAGGATGTGGCAGG - Intronic
923349720 1:233092209-233092231 CAGGGGACAGAGGGTGTGATGGG + Intronic
923611588 1:235500367-235500389 CATGTAACAGAGGCTGAGGCAGG + Intronic
924625304 1:245692478-245692500 CAGGGCATCGAGGCTGAGGCAGG + Intronic
1063598326 10:7457670-7457692 CAGGGAAAAGAGGTTGTGGAAGG - Intergenic
1063641183 10:7832206-7832228 GTGGTTACAGAGGCTGGGGCAGG - Intronic
1064603690 10:17017186-17017208 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1065082287 10:22140457-22140479 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1065826233 10:29574410-29574432 CATGGTACACGGGCGGTGGCTGG + Intronic
1066054188 10:31665053-31665075 CAGGTTGCAGATCCTGTGGCCGG + Intergenic
1066986774 10:42475359-42475381 CAGGGTATAGATGCTGGGGTGGG - Intergenic
1067090340 10:43263137-43263159 GAGGGAACAGATGCTGTGGCTGG + Intronic
1069137461 10:64783234-64783256 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1069588981 10:69630382-69630404 CGGGCTCCAGAGGCTGGGGCTGG + Intronic
1069622921 10:69848952-69848974 CTGAGTACAGAGGCAGCGGCAGG - Intronic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1069964561 10:72103593-72103615 CAGGGAAGAGGGGCTGTGGAAGG - Intronic
1070290321 10:75109573-75109595 CAGGGTGCAGAGGAGGTGGCTGG + Intronic
1070496993 10:77033727-77033749 CAGGCTACTGAGGCAGTGGTGGG - Intronic
1070540573 10:77412522-77412544 CAGGGCACACAGCCTGTGCCTGG - Intronic
1071269321 10:83992205-83992227 TTGGGAACAGAGGCTGTGGGAGG - Intergenic
1071299731 10:84247597-84247619 CAGGGTATTGAGGCTGAGACCGG - Exonic
1072371767 10:94771715-94771737 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1073142985 10:101261250-101261272 CAAGGTACGGGGGCTCTGGCTGG + Intergenic
1073370791 10:102987141-102987163 TAGGGTACAAAGGCTGAGGGTGG + Intronic
1074088359 10:110225918-110225940 CAGGGGGCAGAGGCAGGGGCGGG + Intronic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1075488721 10:122848074-122848096 CAGGGGACAGAGACAGTGCCCGG + Intronic
1075641924 10:124070893-124070915 CAGCCTACGGAGTCTGTGGCAGG - Intronic
1075810542 10:125221861-125221883 GAGGGTGGGGAGGCTGTGGCTGG - Intergenic
1075832022 10:125419703-125419725 TAGGAAACAGAGGCAGTGGCTGG + Intergenic
1076136953 10:128051755-128051777 CAGGGTAGAGACGCGGTGGAGGG + Intronic
1076191040 10:128483614-128483636 CAGGGTGCTGAGGACGTGGCTGG + Intergenic
1076570842 10:131431994-131432016 CAGGGGACAGGAGCTGGGGCTGG + Intergenic
1077027631 11:448308-448330 CAGGGTGCAGAGGCCGGGGCGGG - Intronic
1077142130 11:1029354-1029376 CAGGGTGCACCGGCTGTGGGTGG + Exonic
1077675762 11:4191893-4191915 CTGGGTACAGGGGATGGGGCTGG + Intergenic
1077812659 11:5654349-5654371 TAGGGTACTGAGGCTTTGACTGG + Intergenic
1078097926 11:8311819-8311841 TAGGGGACTGAGGCTGCGGCAGG - Intergenic
1078430073 11:11281714-11281736 TAGGGTGCTGAGGCTGTGGCTGG - Intronic
1078693984 11:13610722-13610744 CAGGATGCAGTGGCTGTGGTTGG + Intergenic
1078911608 11:15737883-15737905 CTGGGTACAGAATCTGTGGATGG + Intergenic
1079076159 11:17386653-17386675 AAGGCTGCAGAGGCTGTGGGAGG - Exonic
1079648472 11:22896330-22896352 TAGGGTACAGAGGCTGGGCGCGG + Intergenic
1079731358 11:23940010-23940032 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1081865127 11:46355532-46355554 CAGGAAACTGAGGCTGAGGCAGG + Intronic
1081992175 11:47343682-47343704 CAAGCTACTGTGGCTGTGGCTGG + Intronic
1083472819 11:62895569-62895591 CAGAGAACAGAGCCTGGGGCTGG + Intergenic
1083616653 11:64029569-64029591 GATGGTGCAGAGTCTGTGGCAGG - Intronic
1083770372 11:64863778-64863800 CAGGTCACAGAGTCAGTGGCAGG - Intronic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084209663 11:67615163-67615185 CATGGTACAGCGACAGTGGCAGG - Intergenic
1084210877 11:67621680-67621702 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1084603832 11:70161583-70161605 GATGATACTGAGGCTGTGGCTGG - Intronic
1085188073 11:74592941-74592963 CTGGGAACAGAGCCTGGGGCTGG + Intronic
1085733100 11:79016020-79016042 CAAGGTACTGAGAGTGTGGCTGG + Intronic
1086183996 11:83991642-83991664 TATGGTAAGGAGGCTGTGGCAGG - Intronic
1087074891 11:94119835-94119857 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1087459116 11:98423426-98423448 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1088750658 11:112839642-112839664 CAGTGTACACAGGAGGTGGCAGG + Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1089076201 11:115740812-115740834 CTGGGTACAGAGACTGTATCCGG - Intergenic
1089290793 11:117437078-117437100 GATGGTACAGAGGCTGGAGCAGG - Intronic
1089361483 11:117890846-117890868 CTGGGAACAGAGGCTGAGGTTGG - Intergenic
1089443543 11:118534306-118534328 CCGGGTCCAGAAGCTCTGGCCGG - Exonic
1089505025 11:118957063-118957085 AAGGGTGCAGAGGGTGTCGCAGG - Intronic
1089843115 11:121435991-121436013 TATGGTACTGAGGCTGTGGGGGG - Intergenic
1090178655 11:124674030-124674052 CAGGGCTCCGAGGCTGTGTCTGG - Exonic
1090202288 11:124865474-124865496 CAGCGCGCAGAGGCTGTGGAGGG + Exonic
1091134697 11:133178332-133178354 CAGAGTAGGGAGCCTGTGGCTGG - Intronic
1091174829 11:133548579-133548601 CAGGGTCCAGAGGCCTTGTCTGG - Intergenic
1091993589 12:4975672-4975694 CAAGGCACAGAGGCTGTTTCCGG - Intergenic
1092106864 12:5927529-5927551 CAGGGCACAGAAGCTGGGGAGGG - Intronic
1093834306 12:23807751-23807773 CAGGATGCTGAGGCTGAGGCAGG - Intronic
1093928291 12:24930278-24930300 CAGGGGTCAGAGGCTGTGTAGGG - Intronic
1094338230 12:29384186-29384208 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1094450655 12:30580135-30580157 ATGGGAACAGAGGCTGGGGCAGG + Intergenic
1094495213 12:30985010-30985032 CAGGGGACAGTGGCCTTGGCTGG + Intronic
1095359491 12:41319317-41319339 CTGGGTACTGAAGCTGTGGGTGG + Intronic
1095491069 12:42734308-42734330 CCAGGTTCAGAGCCTGTGGCAGG + Intergenic
1095961771 12:47839407-47839429 CAGGGTGTGGAGCCTGTGGCTGG - Intergenic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1096560010 12:52429329-52429351 GATGGTGCAGAGGCTGTGGAAGG + Intronic
1096747731 12:53739364-53739386 CAGGGAGCAAAGGCTATGGCAGG + Intergenic
1096808889 12:54157340-54157362 CAGGGTACACAGACTGTGTGGGG - Intergenic
1096814493 12:54193358-54193380 CAGGGTAGCGAGGCTGAGCCAGG - Intergenic
1096981122 12:55728714-55728736 CAGGGGAAAGGGGCTGGGGCGGG - Intronic
1097081262 12:56432841-56432863 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
1097809146 12:63999650-63999672 CAGGACACAGAGGCTGTGATGGG + Intronic
1100305642 12:93347639-93347661 CCGGGTGCAGCGGCTGAGGCTGG + Intergenic
1100659498 12:96681675-96681697 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1101261137 12:103031661-103031683 CCTGCTACATAGGCTGTGGCAGG + Intergenic
1101704767 12:107211498-107211520 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1103535655 12:121632123-121632145 AAAGGTACAGGGGCTGTGGTTGG + Intronic
1103623748 12:122204018-122204040 CTGGGGACAGAGGCTGGAGCCGG + Intronic
1103747285 12:123133975-123133997 CAGAGTAATGAGGCTGGGGCCGG - Intronic
1103874338 12:124115701-124115723 CAGGAGACAGAGGCTGGGGCTGG - Intronic
1104843190 12:131834359-131834381 AGGGCAACAGAGGCTGTGGCGGG - Intronic
1104884872 12:132100846-132100868 CACGGTGCAGATGGTGTGGCGGG + Intronic
1105614460 13:21999742-21999764 CTGGAGACAGAAGCTGTGGCTGG + Intergenic
1105981339 13:25519283-25519305 AAGGGTACACTGGCTGGGGCTGG - Intronic
1106517331 13:30466102-30466124 CCGGGCAAAGAGGCTGAGGCGGG + Intronic
1108494777 13:51014241-51014263 ATGGGTACAGACTCTGTGGCTGG + Intergenic
1109020686 13:57087997-57088019 CAGAGCACAGAGGCTGAGGTTGG + Intergenic
1109261601 13:60150953-60150975 CAATGTACAGAGGCTGTAGTAGG + Intronic
1109500928 13:63235523-63235545 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1109606329 13:64702859-64702881 CAGGAGGCAGAGGCTGAGGCAGG - Intergenic
1109687901 13:65844595-65844617 CCGGGTACGTCGGCTGTGGCAGG - Intergenic
1110641171 13:77826080-77826102 CAATGTACAGAGGCTGTTCCTGG - Intergenic
1110787559 13:79548589-79548611 CAGTGTAAAGAGTCAGTGGCGGG + Intronic
1111372427 13:87335169-87335191 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112422917 13:99269123-99269145 GAGGATACTCAGGCTGTGGCTGG + Intronic
1112519004 13:100079923-100079945 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1112901725 13:104365180-104365202 CAGGGGAGATAGGATGTGGCTGG - Intergenic
1113434806 13:110282672-110282694 CAGGGTACAGACCCTGTGCTTGG - Intronic
1113808576 13:113123827-113123849 CAGGGGACAGAGGCTGGGGAGGG - Intronic
1114539309 14:23443063-23443085 CAGGTAACAGAGGCTGAGGTGGG - Intergenic
1115170875 14:30505369-30505391 CAGGAAGCAGAGGCTGTGGTTGG - Intergenic
1115940312 14:38601542-38601564 CTGGCTACAGCGGCTGTGCCAGG + Intergenic
1115965550 14:38883742-38883764 GAGACTACAGAGGCTGAGGCAGG - Intergenic
1117959066 14:61145309-61145331 CAGGGTAAATAGGCTTTGGAGGG - Intergenic
1121140759 14:91539537-91539559 CAGTGTTCAGAGGCTGTGCAGGG + Intergenic
1121318264 14:92974953-92974975 CAGGGCACAGGGGCTAGGGCAGG + Intronic
1121489997 14:94351202-94351224 CAGCTTATAGAGGCTGAGGCAGG + Intergenic
1121826170 14:97011302-97011324 CAGGGCAGAGTGGCAGTGGCAGG + Intergenic
1122057586 14:99115082-99115104 ATGGGTAAATAGGCTGTGGCAGG + Intergenic
1122772549 14:104103816-104103838 CAGGGGACAGGGCCTGGGGCTGG - Intronic
1122790199 14:104181167-104181189 TAGGGTCCCGAGGCTGGGGCAGG + Intergenic
1202939861 14_KI270725v1_random:136563-136585 CAGGCCACAGAGGCCGAGGCAGG + Intergenic
1124061018 15:26293826-26293848 GAGGGTCCAGTGGCTGTGGCTGG + Intergenic
1124200148 15:27672299-27672321 CTGACTGCAGAGGCTGTGGCTGG + Intergenic
1124223991 15:27873311-27873333 CAGAGGACAGTGGCTGTGTCTGG - Intronic
1124688186 15:31799847-31799869 CAAGGTTCACAGGCTGTGGTGGG + Intronic
1125117585 15:36113339-36113361 CATGTTACAGAGGCAGGGGCGGG - Intergenic
1125299416 15:38238578-38238600 CATGGAAGGGAGGCTGTGGCAGG + Intergenic
1125693298 15:41614438-41614460 CCAGCTACAGAGGCTGAGGCAGG - Intergenic
1125724786 15:41862673-41862695 CCGGGGTCAGAGGCTGGGGCAGG + Intronic
1125726290 15:41869972-41869994 CAGGGTGCAGAAGCTGTGTCCGG - Exonic
1127026721 15:54815112-54815134 CAGGGTACAGCCCCTGTAGCTGG - Intergenic
1128092578 15:64928937-64928959 CAGGGTGTAGAGACCGTGGCAGG - Intronic
1129686926 15:77691558-77691580 GAGGGTCCAGTGGCAGTGGCTGG - Intronic
1129700945 15:77768448-77768470 GTGAGGACAGAGGCTGTGGCTGG - Intronic
1130310629 15:82750678-82750700 CAGGTTTCAGAGGATGCGGCTGG + Intergenic
1131967734 15:97862312-97862334 CATGGTCCAGAGGATGTAGCCGG - Intergenic
1132764304 16:1526555-1526577 CAGGGGGCCGTGGCTGTGGCAGG + Intronic
1132887116 16:2187132-2187154 CAGGGCAGAGGGGCAGTGGCTGG - Intronic
1134058465 16:11184537-11184559 CTGGGCCCAGAGCCTGTGGCAGG - Intergenic
1134248801 16:12559865-12559887 CAGATTTCAGAGGCTGAGGCAGG + Intronic
1134544069 16:15094285-15094307 TCCGGGACAGAGGCTGTGGCTGG - Exonic
1135361640 16:21820436-21820458 TCCGGGACAGAGGCTGTGGCTGG - Intergenic
1135509983 16:23074147-23074169 CAGGGAACTGTGTCTGTGGCGGG + Intronic
1135845943 16:25918691-25918713 CAGAGTGCTGAGGCTGAGGCTGG + Intronic
1136260893 16:29074959-29074981 TCCGGGACAGAGGCTGTGGCTGG + Intergenic
1136282591 16:29222489-29222511 GAGGGTTCTGAGGCTGTGCCTGG + Intergenic
1138583533 16:57956643-57956665 CAGAGTTCAGGGGCTGTGGGTGG - Intronic
1139914882 16:70421769-70421791 CAGGATGCTGAGGCTGAGGCAGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141347635 16:83261856-83261878 CAAGGAACAGAGGCAGTGGGAGG + Intronic
1141598431 16:85111400-85111422 GCGGGAACAGAGGCTGTGTCTGG - Intronic
1141825323 16:86475007-86475029 CAGAGTCCAGAGGCTGAGGCAGG - Intergenic
1142086966 16:88188412-88188434 GAGGGTTCTGAGGCTGTGCCTGG + Intergenic
1142132229 16:88436337-88436359 CAGGGCCCACAGGCTGAGGCCGG - Exonic
1142558644 17:796672-796694 CAGGGAAGGGAGGCTGAGGCCGG - Intergenic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142962526 17:3559545-3559567 CAGGGGACACAGGCTCAGGCAGG + Intergenic
1143084520 17:4405850-4405872 CACTGCACAGAGGCTGTGGGAGG - Intergenic
1143622428 17:8088124-8088146 CAGGGCCCAGAGTCTGTGACTGG + Intergenic
1144464644 17:15487583-15487605 GAGGCTACAGTGGCTGGGGCAGG - Intronic
1144585141 17:16483164-16483186 GAGGGTAATGAGGCTGGGGCAGG - Intronic
1144773060 17:17770276-17770298 CAGGGGAAGGAGCCTGTGGCTGG + Intronic
1144797398 17:17901530-17901552 AAAGATACAAAGGCTGTGGCTGG - Intronic
1144844383 17:18208635-18208657 TAGGGGACAGAGGCTGATGCTGG + Exonic
1145273034 17:21414743-21414765 CTGGGGCCAGGGGCTGTGGCCGG + Intronic
1146022939 17:29294020-29294042 GATGGTGCTGAGGCTGTGGCTGG + Exonic
1146400101 17:32495096-32495118 CATGGTGCCGAGGCTGTGGTTGG - Intronic
1146628742 17:34454812-34454834 CAGGGTGCAGGGGTTGTTGCAGG + Intergenic
1147421096 17:40322562-40322584 CAGGGGACAGAGGCTCCGGGGGG - Intronic
1147743654 17:42682546-42682568 CAGGAGACAGAGGCTGGGGAAGG + Intronic
1148748447 17:49931263-49931285 TAAGGGACAGAGGCTGAGGCTGG + Intergenic
1148895877 17:50838807-50838829 CGGGGAACAGAGGCTGTGAGAGG - Intronic
1150352488 17:64456688-64456710 CCAGCTACAGAGGCTGAGGCAGG + Intronic
1151398269 17:73839213-73839235 CAGGGTCCCGAGGCTGGGGTAGG + Intergenic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151715998 17:75831336-75831358 CAGGGTCAGGAGGCTGGGGCGGG + Exonic
1151937566 17:77272208-77272230 CAGGTGTCAGAGGCAGTGGCGGG + Intergenic
1152089438 17:78238645-78238667 GAGGGTACAGAGTGTGTGGGGGG + Intronic
1152120438 17:78415053-78415075 CAGGGCGCTGAGGGTGTGGCTGG + Intronic
1152626510 17:81390251-81390273 CAGGGTAAGGGGGCTGAGGCAGG - Intergenic
1152691973 17:81722436-81722458 CAGGGTGCAGAGGGTGGGGTGGG + Intergenic
1152936146 17:83138046-83138068 CCCAGTTCAGAGGCTGTGGCAGG - Intergenic
1153166020 18:2263023-2263045 CTGGGTACAGAGACTGAGGTGGG + Intergenic
1153281264 18:3416402-3416424 CCAGCTACAGAGGCTGAGGCAGG + Intronic
1154199794 18:12291415-12291437 CAGGGGGCAGAGGCTGTGGGGGG - Intergenic
1154299962 18:13184341-13184363 CTGGGGAGAAAGGCTGTGGCTGG + Intergenic
1155172905 18:23280346-23280368 CTGGGTACTGAGGCTGAGGCCGG + Intronic
1156457371 18:37302368-37302390 CAGGGGACAGAGGCAGTGTGAGG - Intronic
1157282393 18:46354617-46354639 CATGGTGCTGATGCTGTGGCTGG - Intronic
1157582444 18:48781402-48781424 CAGGGGCCAGTGGCTGTGGGTGG + Intronic
1157632902 18:49117723-49117745 CAGTGCACAGTGGGTGTGGCAGG - Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160569075 18:79804262-79804284 CAGGGTCCAGCGGCTGTGGCTGG - Intergenic
1161270470 19:3386888-3386910 TAGGGTCCCCAGGCTGTGGCTGG + Intronic
1161573052 19:5040846-5040868 CAGGGGACAGAGGCCCTGGGAGG - Intronic
1161598348 19:5164287-5164309 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1161687691 19:5711487-5711509 CAGGGGACACGGGCTGGGGCTGG + Intronic
1161729680 19:5951665-5951687 CAGGGGTCAGAGGCTGGAGCTGG + Intronic
1161943270 19:7419068-7419090 CAGGGTACAGAGGCCGAGTGTGG - Intronic
1161943289 19:7419157-7419179 TGGGGTACAGAGGCTGAGGGTGG - Intronic
1162310759 19:9905826-9905848 CAGGGTATAGCGCCTGTGCCAGG - Intronic
1162345404 19:10115443-10115465 CAGGGAGCAGGGGCTGGGGCAGG + Intronic
1162967173 19:14161449-14161471 CTGGGGACTGGGGCTGTGGCTGG + Exonic
1163843599 19:19626760-19626782 CAGGGCACAGAGGCAGTGCCAGG + Exonic
1164123674 19:22290774-22290796 CAGTGTGCAGAGTCTGTGTCTGG + Intronic
1164993092 19:32698616-32698638 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1165002524 19:32776683-32776705 CAGGAGAGAGAGGCTGTGGCAGG + Intronic
1165106044 19:33470184-33470206 CAGGCCAGAGAGGCTGGGGCTGG - Intronic
1165112325 19:33509623-33509645 TGGGCTGCAGAGGCTGTGGCTGG - Intronic
1166103560 19:40586153-40586175 CAGAGAACAGAGGCCGAGGCAGG - Intronic
1166166250 19:40991229-40991251 CAGGGTGCAGAGGCAGGGTCAGG + Intergenic
1166572823 19:43809490-43809512 CCAGTTACAGAGGCTGAGGCAGG - Intronic
1166634180 19:44434993-44435015 CAGGCAAGAGAGGCTGTGGAGGG - Intronic
1166675373 19:44737754-44737776 CAGGATACTGAGGATGGGGCAGG - Intergenic
1167259453 19:48450322-48450344 CTGGGTGAAGAGCCTGTGGCTGG + Exonic
1167479424 19:49720487-49720509 CAGGTTATAAAGGGTGTGGCTGG - Intergenic
1168313526 19:55473507-55473529 CAGGGCTCAGAGTCTGAGGCTGG + Intergenic
1168625479 19:57914836-57914858 CAGGATACTGAGGCCATGGCAGG - Intronic
925072574 2:982836-982858 CAAGGTGCAGAGACTGTGCCTGG + Intronic
925280608 2:2682047-2682069 CAGGGTGCAGAGGCTGGCGGGGG + Intergenic
925901784 2:8514069-8514091 CAGGAGACAGAGGGTGAGGCGGG + Intergenic
925950011 2:8901067-8901089 CAGGGTCCAGGGACTGTTGCAGG - Intronic
925950036 2:8901226-8901248 CAGGGTCCAGGGACTGTTGCAGG - Intronic
926219013 2:10922845-10922867 CAGGCTACAGCGGGTGAGGCTGG - Intergenic
926993727 2:18710267-18710289 CAGCCTACAGAAGCTGGGGCTGG - Intergenic
927461226 2:23300000-23300022 CAGGGGGCAGAGGCACTGGCGGG - Intergenic
929330237 2:40673640-40673662 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
929576805 2:43057260-43057282 CAGGGGACCCAGGCTGTGCCAGG + Intergenic
929931086 2:46256004-46256026 GAGGGTGCAGAGGCTGCTGCAGG - Intergenic
931517276 2:63057371-63057393 CAGGGTACAGAGGTGGGGGTTGG + Exonic
931682550 2:64763720-64763742 CAGGATACAGAGACTGAGGCTGG - Intergenic
931981203 2:67695617-67695639 GAGGCCACAGAGGCTGTGACAGG + Intergenic
934501385 2:94862465-94862487 CAGGGCACAGAGCCTCGGGCAGG + Intergenic
934992280 2:98930286-98930308 CACGGTACAGAGGGTGGGGACGG - Intronic
934992295 2:98930324-98930346 CACGGTACAGAGGGTGGGGATGG - Intronic
934992310 2:98930362-98930384 CACGGTACAGAGGGTGGGGACGG - Intronic
934992325 2:98930400-98930422 CACGGTACAGAGGGTGGGGACGG - Intronic
934992340 2:98930438-98930460 CACGGTACAGAGGGTGGGGACGG - Intronic
936778890 2:116007838-116007860 CAGAGTACAGAGGCTGTCCACGG - Intergenic
936804823 2:116318295-116318317 ATGGGTACTGAGGCTGAGGCAGG + Intergenic
937877624 2:126837303-126837325 AAGGGGACAGAGCCTGGGGCTGG + Intergenic
939243828 2:139597080-139597102 CAGTGTACAGAGGCTGAGGCAGG + Intergenic
940192785 2:151060297-151060319 CAGAGAACAGATGCTGTGGCAGG - Intergenic
941243284 2:163068320-163068342 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
943103193 2:183511300-183511322 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
944238777 2:197465580-197465602 CAGGGGAGAGAGGCTGGGCCTGG - Intronic
945740147 2:213649806-213649828 CATGTTTCAGAGGCTGAGGCAGG - Intronic
946207491 2:218120377-218120399 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
946243675 2:218372832-218372854 AAGGGTATAGAGGCTGTTTCAGG + Intergenic
947182067 2:227420302-227420324 CAGAGTACAGAAGGTGGGGCAGG - Intergenic
947722886 2:232380163-232380185 CTGGGAACAGAGGATGGGGCAGG - Intronic
947727233 2:232408244-232408266 CTGGGAACAGAGGATGGGGCAGG - Intronic
948718843 2:239883468-239883490 CAGGGAACAGACACAGTGGCAGG - Intergenic
948912361 2:241010997-241011019 CAGGGTAGAGATGCTGCGGCAGG - Intronic
1169113304 20:3046611-3046633 CAGGATAGCGAGGCTGCGGCAGG + Exonic
1169804368 20:9544206-9544228 CAGAGTAGATAGGCTGTGGCAGG - Intronic
1170162911 20:13333537-13333559 CAGTGTAAAGAGTTTGTGGCAGG - Intergenic
1170771083 20:19332986-19333008 CAGGCTAAAGGGGCTGTGTCTGG + Intronic
1171033109 20:21694365-21694387 CAGGGCATGGGGGCTGTGGCTGG + Intergenic
1171967717 20:31543122-31543144 CAGGGTTCTGAGGCGGTGGGAGG - Intronic
1172186673 20:33035256-33035278 AAGGGTTCTGAGACTGTGGCTGG + Intronic
1172814912 20:37678673-37678695 CAGGGGAGAGAGGCAGTGGCAGG - Intergenic
1173003322 20:39121206-39121228 CAGGATTCTGAGGCTGTGTCTGG - Intergenic
1173225530 20:41160355-41160377 CAGGGCACACAGCATGTGGCTGG - Intronic
1173818385 20:46004998-46005020 CAGGCCAGAGAGGCTCTGGCAGG - Intergenic
1173941299 20:46913540-46913562 CAGGGGTCAGAGGGTGGGGCAGG + Intronic
1174162327 20:48560468-48560490 CAGGGTCTAGGGGCTGGGGCAGG - Intergenic
1174488479 20:50875810-50875832 CTGGGTACAGTGGCTGTGGTTGG - Intronic
1174783625 20:53412732-53412754 CAGGGGAGAGAGCCTGTGGGTGG - Intronic
1175186484 20:57182415-57182437 CCGGGCACTGGGGCTGTGGCTGG - Intronic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1175309696 20:58003181-58003203 CACTGAACAGAGGATGTGGCGGG - Intergenic
1175810893 20:61856734-61856756 CTGGGCTCAGAGGGTGTGGCAGG + Intronic
1175866549 20:62180819-62180841 CAGGAGACAGAGGTTGTGGTGGG + Exonic
1175910399 20:62402622-62402644 CAGGGTCCAGGGGATGGGGCTGG - Intronic
1175911834 20:62408677-62408699 TAGGGTGCTGAGGCTGGGGCAGG + Intergenic
1175998220 20:62820772-62820794 CAGGGCCCAGAGGGTGTGGAGGG + Intronic
1176200994 20:63860491-63860513 CTGGGCTCAGAGGCTCTGGCTGG + Intergenic
1176583328 21:8550522-8550544 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1177169608 21:17640715-17640737 CAGGGTCCCGAGGCTGTGCAGGG + Intergenic
1177729809 21:25014191-25014213 GAGGGTGCACAGGCAGTGGCTGG - Intergenic
1178492199 21:33059861-33059883 CAGATCACAGTGGCTGTGGCTGG + Intergenic
1178955411 21:37017462-37017484 CAGGGGACAGAGGGTGGGGTGGG + Intronic
1179725413 21:43338963-43338985 CAGGGGCCACAGGCTGTGGTGGG + Intergenic
1180266138 22:10527452-10527474 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1180982501 22:19885461-19885483 CAGAGCACAGAGGCTGGAGCCGG - Intronic
1181048827 22:20229113-20229135 CAGGGGACACAGGCTGGGGGAGG + Intergenic
1181863296 22:25835868-25835890 CAGACTGCAGAGGCTGTTGCTGG + Intronic
1182028019 22:27135640-27135662 CTGGGTACAGAGGGTGAGGGAGG - Intergenic
1183010715 22:34944403-34944425 CATGGTACAGGGGCAGTGGGAGG - Intergenic
1183054259 22:35292989-35293011 CAGGGTATGGTGGCTGTGTCTGG + Exonic
1183407691 22:37638615-37638637 CAAAGTGCAGAGGGTGTGGCAGG + Intronic
1183513845 22:38251712-38251734 CAAGGTCCACAGGCTGTGCCAGG - Intronic
1184555632 22:45231472-45231494 CAGGATACAGAGGCAGGGGTGGG + Intronic
1184971855 22:48028132-48028154 CAGGGCACAGAGGGAGTGGAAGG + Intergenic
949700130 3:6746956-6746978 AAGGCTACAGAGGAGGTGGCTGG - Intergenic
951226304 3:20125191-20125213 CAGGCTCCAGAGGCTGAGGCAGG + Intronic
952452886 3:33448199-33448221 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
952555182 3:34522742-34522764 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
953623075 3:44549280-44549302 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
953770544 3:45776028-45776050 CTGAGGACAAAGGCTGTGGCAGG + Intronic
953846922 3:46434934-46434956 CAGGTTTCAGAGGCTTTTGCAGG + Intergenic
953956292 3:47234528-47234550 CTGGGCACAGTGGCTCTGGCTGG - Intronic
954036095 3:47852064-47852086 AGGGGTGCAGAGGCTGTGGCTGG - Exonic
954215132 3:49120498-49120520 CGGGGTTCAGAGGCTGAAGCTGG - Intronic
954430842 3:50470187-50470209 CAAGGTAGAGATGCAGTGGCAGG - Intronic
954467548 3:50665268-50665290 CAGGGTCCAGGGGAAGTGGCTGG - Intergenic
954598793 3:51851805-51851827 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
956510988 3:69993304-69993326 TGAGGTACAGAGGCTGTGGTGGG + Intergenic
957629124 3:82695632-82695654 CATGGTTCAGAGACTGTGTCTGG + Intergenic
957785562 3:84877793-84877815 CCAGGTACTGAGGCTGAGGCAGG + Intergenic
960844514 3:121993836-121993858 CAGGGGGCAGAGGCTGGGCCAGG + Exonic
961466405 3:127084553-127084575 CTGGGTTCAGAGGCTTGGGCCGG + Intergenic
961492484 3:127265171-127265193 CAGGGCACAGAGGGAGGGGCAGG + Intergenic
963142465 3:141958546-141958568 AAGGGCACAGAGCCTGGGGCAGG + Intronic
964064368 3:152561459-152561481 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
964476179 3:157100003-157100025 CAGGGAGCAGAGGTTGAGGCAGG - Intergenic
965726989 3:171728202-171728224 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
967683707 3:192395707-192395729 CAGGGTATAAAGCCTGGGGCAGG + Intronic
967992505 3:195142083-195142105 CAGGGGAGAGAGGCTGTGGAGGG - Intronic
968618807 4:1594318-1594340 AAGGGGACACAGGCTGGGGCAGG - Intergenic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
968657645 4:1785582-1785604 CTGGACACAGAGGCTGGGGCTGG - Intergenic
969441982 4:7222698-7222720 CAGGCTTCCCAGGCTGTGGCAGG + Intronic
969453262 4:7286833-7286855 CAGGGTACAGGAGCTATGGAAGG + Intronic
969454452 4:7293339-7293361 CAGGGGACAAAGGTGGTGGCTGG - Intronic
969512818 4:7629414-7629436 CAAGTCAGAGAGGCTGTGGCAGG + Intronic
969514551 4:7639076-7639098 CTGGGTTCTGAGGCTGTGGAGGG + Intronic
969722251 4:8898567-8898589 CAGGCTACAGATGATGTGGATGG - Intergenic
970290259 4:14563930-14563952 CAGGGGAAAGAAGCTGTGTCAGG + Intergenic
975047864 4:69826490-69826512 CAGGGTCCAGGGACTGTTGCGGG + Intronic
975254384 4:72216392-72216414 CATGGAAGAGAGGCTGAGGCAGG - Intergenic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
977937759 4:102826749-102826771 CACGGTACAGAGGCTGTTGGTGG - Intronic
978656489 4:111071302-111071324 CAGGGGAAAGAGGCTTTGTCAGG + Intergenic
980168104 4:129252653-129252675 CAGGGTACAGCTCTTGTGGCTGG - Intergenic
980291028 4:130847566-130847588 CAGGGTCCAGGGGCTGTTGTGGG - Intergenic
981205262 4:142033325-142033347 CATGGTCCAGAGGGTGTGGCTGG - Intronic
981606813 4:146548324-146548346 GTGGGCACAGAGGCTGTGGTTGG + Intergenic
984763427 4:183381988-183382010 CAGGACACAGAGGCTGTGCTGGG - Intergenic
985520275 5:370862-370884 CAGAGCACAGAGGCTGGGCCTGG + Intronic
985824528 5:2182422-2182444 CAGGGTACATTGGCTCAGGCTGG - Intergenic
986209631 5:5658907-5658929 AACTGTACATAGGCTGTGGCTGG + Intergenic
986327137 5:6684792-6684814 CACTGTGCAGAGGCTGTTGCAGG + Intergenic
986354895 5:6914100-6914122 CGGGTGACAGAGGCTGTGGAGGG + Intergenic
986354906 5:6914159-6914181 CAGGTGACAGAGGCTGTGGAGGG + Intergenic
986739847 5:10696322-10696344 CAGGGAATAGGGGGTGTGGCGGG + Intronic
987318618 5:16747484-16747506 CAGGGTGCAAAGGCTGAGACAGG + Intronic
988605646 5:32676414-32676436 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
990004531 5:50930749-50930771 CTGGGTGCAGAGGCTCAGGCCGG + Intergenic
991512775 5:67398089-67398111 CAGGGTTGAGATGCTGAGGCAGG - Intergenic
994259559 5:97641196-97641218 CAGGGTAGAGATGGTGTGGGAGG + Intergenic
995245566 5:109931543-109931565 CTTGGTTCAGAGGCTGTGGCTGG + Intergenic
996102723 5:119460924-119460946 CAGGTTACTGAGGCTGCAGCAGG + Intronic
997341446 5:133148089-133148111 CGGGGTGCAGAGGCTATGGAGGG - Intergenic
997422701 5:133781657-133781679 CAGGGTACACACAGTGTGGCAGG - Intergenic
997464341 5:134077339-134077361 CAGGGAACAAAGGCTTTGGTAGG - Intergenic
998224467 5:140315795-140315817 CTGGGCACAGAGGCTGAGGTGGG + Intergenic
998849339 5:146338804-146338826 CCGGGTATAAAGGCTGTGGAGGG + Intronic
999430508 5:151521557-151521579 CAGCCTGCAGAGGCCGTGGCTGG - Exonic
1000160930 5:158597244-158597266 CAGGGTACTGGGGCTGGGGCTGG - Intergenic
1001743040 5:174069292-174069314 GAGGGTACTGAGGCTCTGGAAGG + Intronic
1001776704 5:174334284-174334306 CAGAGCACAGAGGCTGAGGCTGG + Intergenic
1001960048 5:175874445-175874467 CTGGGTGCTGGGGCTGTGGCAGG - Intronic
1002417073 5:179126261-179126283 CAGGGCACCGAGCCTGCGGCTGG + Intronic
1002575318 5:180170889-180170911 CAGGGGACAGGGGCAGGGGCAGG - Intronic
1002640974 5:180630476-180630498 CAGGGTCCACAGGCTGGGGGCGG + Intronic
1002803614 6:550895-550917 CAGGGCAGAGAAGATGTGGCAGG - Intronic
1003060086 6:2856178-2856200 CAGGCAGCAGAGCCTGTGGCTGG - Intergenic
1003179235 6:3777839-3777861 CCGGGCACTGAGGCTGTGGGTGG + Intergenic
1003369727 6:5512619-5512641 TAGGTTACAGATGCTGTGCCAGG + Intronic
1003432525 6:6053092-6053114 CTGGGGACAGAGGCTCTGTCTGG + Intergenic
1003954999 6:11154617-11154639 CAGGGTCTAGAGGCTCTGGATGG - Intergenic
1004110882 6:12717511-12717533 GAGGGTGCAGAGGCTGAGGCTGG + Exonic
1004219592 6:13734646-13734668 TAGGGTACAGAGTTTGTGTCTGG + Intergenic
1005057186 6:21740282-21740304 CAGGATACAGATGCTTTGGAGGG + Intergenic
1006178891 6:32141824-32141846 CGGGGTACAGATGAGGTGGCAGG + Intergenic
1006381618 6:33701465-33701487 CAAGGTACAGACACTGTGGGAGG - Intronic
1006983214 6:38162069-38162091 CAGGTTCCAGAGGGTGTTGCTGG + Intergenic
1007380166 6:41485035-41485057 CAGGGTAGAGAGACTGGGGGTGG + Intergenic
1007474169 6:42107798-42107820 CAGGCTTCAAAGGCTGTGCCAGG - Intronic
1008600451 6:53089030-53089052 AGGGCTACAGAGGCTGAGGCAGG - Intronic
1010661641 6:78578431-78578453 CAGGTTACTGAGACTGAGGCAGG - Intergenic
1011156684 6:84341126-84341148 CACGGTACAGAAGCTGTGGCAGG - Intergenic
1011260837 6:85468297-85468319 CAGGGTGGAGCGGCTGGGGCTGG + Intronic
1011278173 6:85650168-85650190 CAGGAGGCAGAGGTTGTGGCGGG - Intergenic
1012268709 6:97180432-97180454 CAGGGTAGAGAGGATGGGGATGG + Intronic
1013310011 6:108884958-108884980 CAGGGAGCAGTGGCTGTGACTGG - Intronic
1014150099 6:118044514-118044536 CATGGCTCAGAGGCTGTGACTGG + Intronic
1014313234 6:119831007-119831029 CAAAGCACAGAAGCTGTGGCAGG - Intergenic
1016667354 6:146657587-146657609 GAGAGTGCAGAGGCAGTGGCAGG - Intronic
1017001192 6:149999016-149999038 CAGGGTACAGAGCCAGGGGTAGG - Intergenic
1017159863 6:151354781-151354803 CAGGAGACAGAGGCAGAGGCAGG - Intronic
1017681581 6:156869992-156870014 CAGGGAGCAGTGGCTGGGGCAGG + Intronic
1018148573 6:160917558-160917580 TAGGGTAGAGAGGCTGGGGAAGG - Intergenic
1018229426 6:161661527-161661549 CAGGTGACAGAGGCTGGGGCAGG - Intronic
1018787206 6:167117245-167117267 CAGGATGCAGAGGCTGTGGTAGG - Intergenic
1019217287 6:170452132-170452154 CAGGGCACAGTGGCTGGTGCGGG - Intergenic
1019516488 7:1442455-1442477 CTGGGAACAGCGGCAGTGGCTGG + Exonic
1019564200 7:1671497-1671519 CTGGGGACAGAAGCTGTGGAGGG + Intergenic
1021928571 7:25556779-25556801 CGGGGTCCAGATTCTGTGGCGGG - Intergenic
1022505728 7:30907822-30907844 CAGGGCAGAGGGGCTGAGGCGGG - Intergenic
1024541356 7:50477459-50477481 CAGTCAACAGGGGCTGTGGCAGG + Intronic
1025091431 7:56067424-56067446 CAGGGTGCAGAGGCTAAGGCAGG - Intronic
1025143811 7:56487250-56487272 CCGGGTACAGTGGCTCAGGCCGG + Intergenic
1025295412 7:57772290-57772312 GAGGCCACGGAGGCTGTGGCAGG + Intergenic
1025903648 7:65767416-65767438 CAGGGTGCAGAAGCTAAGGCAGG - Intergenic
1026095504 7:67343332-67343354 CAGGGACCAGAGACTGTTGCTGG + Intergenic
1026968645 7:74454904-74454926 CAGGGTACTTAGGATGGGGCGGG - Intronic
1027267998 7:76504533-76504555 CGGAGGACAGAGGCTGAGGCCGG + Intronic
1027319809 7:77004395-77004417 CGGAGGACAGAGGCTGAGGCCGG + Intergenic
1027399651 7:77794379-77794401 CAGTTTAAAGAGGCTGTTGCAGG + Exonic
1028347225 7:89798115-89798137 CAGGTTACATAGGCTGAGGTAGG + Intergenic
1028563244 7:92198736-92198758 AAGGGTACAGAGCCTGAGTCAGG + Intergenic
1028738033 7:94240062-94240084 GAGGCTACAGAGGCTGAGGCGGG + Intergenic
1030190241 7:106803506-106803528 CAGGAGACAGAGGCTCTGGATGG - Intergenic
1031731616 7:125309399-125309421 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1031731627 7:125309479-125309501 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1032428639 7:131842796-131842818 CAGGGTGTAGAGGCAGGGGCTGG - Intergenic
1032640631 7:133763205-133763227 CTGGAAGCAGAGGCTGTGGCAGG - Intronic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1032791378 7:135245584-135245606 AAGGGGACAGAGGCTCTGGCTGG + Intronic
1032853023 7:135811279-135811301 CAGGGCTCAGGGGCTGTGGGTGG + Intergenic
1033411376 7:141120851-141120873 CAGGGATCAGAGGCTGAGGTGGG + Intronic
1033615394 7:143009515-143009537 CAAGGAACAGAGGCAGGGGCTGG - Intergenic
1034203030 7:149294315-149294337 CCGGCTGCAGAGCCTGTGGCAGG + Intronic
1034227835 7:149497214-149497236 GAGGGGACAGCGGCTGGGGCGGG + Intronic
1034243004 7:149624260-149624282 TAGGGTTCAGCGGCTGGGGCGGG + Intergenic
1034490938 7:151392698-151392720 CAGGGTGCACAGCCTGTGACAGG - Intronic
1034539408 7:151746735-151746757 GAGAATTCAGAGGCTGTGGCCGG + Intronic
1035128578 7:156629834-156629856 CAGTGTCCAGAGGCTGTGCAGGG - Intergenic
1035132422 7:156668447-156668469 CAGAGGACAGAGGCTGTTGAGGG + Intronic
1035242408 7:157540838-157540860 CAGGGAGCCGACGCTGTGGCAGG - Intronic
1035390077 7:158497795-158497817 CAGGGCCCAGAGGCTGTGCAGGG - Intronic
1035583786 8:756740-756762 CAGGGTGAGGAGGGTGTGGCTGG - Intergenic
1037558611 8:20052466-20052488 CAGGAGATAGAGGCTGTGGTGGG - Intergenic
1037716347 8:21404163-21404185 CTGGGCACGGAGGCTGAGGCAGG + Intergenic
1037717098 8:21409873-21409895 CAGGGTGCTGAGGATGTGGCTGG - Intergenic
1037946175 8:22990941-22990963 GAGGGGTCAGAGGCTGTGTCGGG + Intronic
1038244770 8:25845337-25845359 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1039693328 8:39883838-39883860 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1040953239 8:52956292-52956314 CAGGGTGCAGGGACTGTTGCGGG + Intergenic
1041850018 8:62379914-62379936 GAGGATACAGAGGCTCAGGCAGG + Intronic
1042055342 8:64758290-64758312 AAGGGTTCTGAGGCTGTGTCTGG - Intronic
1042091764 8:65166355-65166377 CAGAGGACAGAGGCTCCGGCTGG - Intergenic
1042820050 8:72920529-72920551 CAGGATACTGAGGCTGAGGTGGG + Intronic
1043521320 8:81048524-81048546 CAGGTCACAGCGGCTGGGGCAGG - Intronic
1044364105 8:91323267-91323289 CAGGGGATAGAAGATGTGGCAGG + Intronic
1046239344 8:111470797-111470819 CAAGGGACAGAGGCTGAGGGGGG + Intergenic
1047447365 8:124931307-124931329 GAGTGTTCTGAGGCTGTGGCTGG + Intergenic
1048044122 8:130757068-130757090 GAGGGTACAGGGGCTGGGTCTGG + Intergenic
1048578179 8:135709367-135709389 CACGTTCCAGGGGCTGTGGCAGG + Intergenic
1049194945 8:141309872-141309894 CAGGGCACAGAGGACGTGTCTGG + Intergenic
1049510478 8:143024546-143024568 AAGGGGGCAGAGGCTGTGGATGG - Intergenic
1049511387 8:143028439-143028461 AAGGGGGCAGAGGCTGTGGATGG - Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1049544191 8:143221850-143221872 CAGGGGACAGAGGCTGGGTGCGG - Intergenic
1049544246 8:143222002-143222024 CAGGGGACAGAGGCTGAAGGGGG - Intergenic
1049591744 8:143465893-143465915 CAGGGCCCAGAGACGGTGGCTGG + Intronic
1049633581 8:143673233-143673255 GAGGTTACAGTGGCTGTTGCTGG + Intergenic
1049675617 8:143887599-143887621 CAGGGCACAGGGCCTGGGGCTGG + Intergenic
1049819006 8:144622860-144622882 CAGGGGAGAGAGGCTGGGCCAGG + Intergenic
1050610611 9:7348903-7348925 CTGGGTATAGAGGCAGAGGCTGG + Intergenic
1051729963 9:20130917-20130939 CAGGTTACTGAGGCTGGGTCTGG - Intergenic
1053370087 9:37553471-37553493 GAGGGTACAGGGGTTGTGCCAGG - Intronic
1053414444 9:37938208-37938230 CAGGGCTCAGAGGCTGAGACGGG + Intronic
1056910468 9:90695878-90695900 TAGAGGACAGAGGCTGTGGAGGG - Intergenic
1056940342 9:90950088-90950110 CAGGGATCAGAGACTGTGGTGGG - Intergenic
1057258225 9:93567845-93567867 CAGGGGTCAGTGGCTGTGGGTGG + Intergenic
1057296559 9:93848017-93848039 CAGGGCTCAGAGACTGTGCCAGG - Intergenic
1057301906 9:93891438-93891460 TAGGGTACAGGGGCTGTCCCTGG + Intergenic
1057606855 9:96504756-96504778 GAGGGTCAAGAGGCAGTGGCAGG + Intronic
1058189165 9:101891913-101891935 CAGTTTACAGAGGCTGTGCACGG + Intergenic
1058687265 9:107489704-107489726 CGGGGAGCAGAGGCGGTGGCGGG - Intronic
1059570248 9:115426602-115426624 CATGGTAAAGAGGCTGTGTCAGG + Intergenic
1059617590 9:115967645-115967667 CAGTGTCCAGAGGCTGTGCAGGG + Intergenic
1059991792 9:119872363-119872385 CTAGGTACAGGGGCTGGGGCTGG + Intergenic
1060115316 9:120935644-120935666 CAGGAAGCAGAGACTGTGGCAGG + Intergenic
1060348680 9:122838590-122838612 CAGGGTATAGGGGCAGTGCCAGG + Intergenic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1060747314 9:126146148-126146170 CAGGGACCTGAGGCTGAGGCTGG - Intergenic
1060799545 9:126535026-126535048 CCGGGTCCTGAGGCTGGGGCGGG - Intergenic
1061441022 9:130603414-130603436 TAGGGCACAGAGCCTGTGCCAGG - Intronic
1061480004 9:130893118-130893140 CACGGAGCTGAGGCTGTGGCTGG - Intergenic
1061499414 9:130993502-130993524 CAGGGGCCAGAGGCTGGGGCTGG + Intergenic
1061587973 9:131580549-131580571 CAGAGGCCAGAGGCTGAGGCGGG - Intronic
1061750997 9:132776916-132776938 CAGAGCACAGAGGCTGTCCCAGG - Intronic
1062094987 9:134698521-134698543 GAGGATGCAGAGGCTGTGACAGG + Intronic
1062621627 9:137424990-137425012 CAGGGTGCAGAGGGTGTCGCTGG + Intronic
1203613283 Un_KI270749v1:28289-28311 CAGGCCACAGAGGCCGAGGCAGG - Intergenic
1185734036 X:2484085-2484107 CCAGGTACTGAGGCTGAGGCAGG - Intronic
1186495735 X:10011923-10011945 GAGTGTCCAGAGGCAGTGGCTGG + Intergenic
1186609525 X:11125429-11125451 CTGGGAACAGAGTCTGTGGGTGG + Intergenic
1187172094 X:16861993-16862015 CAAGTTACAGTTGCTGTGGCTGG + Intronic
1187245303 X:17548428-17548450 CAGGGAACAGAGGCTGGGGTGGG + Intronic
1187487954 X:19722345-19722367 GAGGGTAATGAGGCTGTGGCAGG - Intronic
1188033915 X:25295698-25295720 CAGTGTACAGAGGGCTTGGCGGG - Intergenic
1188734557 X:33696457-33696479 TGAGGTACAGAGGCAGTGGCAGG - Intergenic
1189268352 X:39733434-39733456 CAGGGTGTAGAGGGTGTGGTGGG - Intergenic
1189297490 X:39929245-39929267 CAGGGTGCAGAGGCATGGGCGGG + Intergenic
1190119162 X:47646401-47646423 CTGGGCACAGAGGCTGAGGTGGG - Intronic
1190418624 X:50205541-50205563 CTGGGTGCAGTGGCTGCGGCAGG + Intronic
1192213582 X:69142890-69142912 CTTGGTGCAGAGGCTGTGGCAGG - Intergenic
1192482938 X:71500564-71500586 CAGGGTCCAGGGGCCGTTGCGGG - Intronic
1194798372 X:98240564-98240586 CTGGCTACAGAGGCTTTGCCTGG + Intergenic
1194959947 X:100223780-100223802 CAGGCTGCAGAGGCTGTAGGAGG - Intergenic
1195439416 X:104884405-104884427 CAGGGTCCAGGGACTGTTGCAGG + Intronic
1195902608 X:109814819-109814841 GAGGGTACTGCTGCTGTGGCTGG - Intergenic
1196488830 X:116245152-116245174 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1197241234 X:124125271-124125293 GAGGGTAAAGAGGCTGGGGGGGG - Intronic
1198444673 X:136700276-136700298 CAGGATTGGGAGGCTGTGGCAGG + Intronic
1198942213 X:141968323-141968345 CCGGGTGCAGAGGCCGAGGCGGG - Intergenic
1200225316 X:154413707-154413729 GAGGGGACAGAGGCTGTGGGAGG + Intronic
1201516111 Y:14820051-14820073 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1201631106 Y:16072828-16072850 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1202032218 Y:20589272-20589294 GAGGGTGCAGAGGGTGAGGCAGG - Intronic