ID: 1142696935

View in Genome Browser
Species Human (GRCh38)
Location 17:1639003-1639025
Sequence TACCCAGAAGCTTCTTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142696928_1142696935 22 Left 1142696928 17:1638958-1638980 CCTTCCTGTCTCCTACACATCCT 0: 1
1: 0
2: 2
3: 66
4: 556
Right 1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 245
1142696929_1142696935 18 Left 1142696929 17:1638962-1638984 CCTGTCTCCTACACATCCTGTCT 0: 1
1: 0
2: 1
3: 26
4: 289
Right 1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 245
1142696931_1142696935 2 Left 1142696931 17:1638978-1639000 CCTGTCTTTGCTCTGAGTTGCCT 0: 1
1: 0
2: 2
3: 30
4: 274
Right 1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 245
1142696930_1142696935 11 Left 1142696930 17:1638969-1638991 CCTACACATCCTGTCTTTGCTCT 0: 1
1: 0
2: 2
3: 36
4: 311
Right 1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142696935 Original CRISPR TACCCAGAAGCTTCTTCCTG GGG Intronic
900102341 1:967212-967234 TACCCAGCGGCAACTTCCTGCGG - Intronic
901201259 1:7468719-7468741 TACCCAGGAGTTGCTGCCTGAGG + Intronic
901878363 1:12179983-12180005 AAGCCTGAAGCTTCTCCCTGTGG + Intronic
903974637 1:27141399-27141421 CAGCCAGAAGCTTCTACTTGGGG - Intronic
904282097 1:29427736-29427758 TACTCAGATGCTTCCTCCTCAGG + Intergenic
904861271 1:33540027-33540049 GACCCAGAACCTGCTTACTGGGG + Intronic
905279989 1:36842934-36842956 GACCCACAAGCACCTTCCTGGGG - Intronic
906615081 1:47228545-47228567 ACCCCAGGAGATTCTTCCTGGGG + Intronic
910467398 1:87515067-87515089 CTCCCAGAAACTTCTTCCTGAGG - Intergenic
910495430 1:87821640-87821662 GACCCACAAACTTCTTTCTGTGG - Intergenic
911036549 1:93556196-93556218 AACCCAGAATCTCCATCCTGAGG + Intergenic
913919408 1:124813933-124813955 TTCTCAGAAACTTCTTCGTGAGG + Intergenic
913921924 1:124843013-124843035 TTCTCAGAAACTTCTTCGTGAGG + Intergenic
915319010 1:155045977-155045999 CACTCACCAGCTTCTTCCTGCGG - Exonic
915453756 1:156025217-156025239 TACCTAGAAGCATCTACCTCAGG - Intergenic
915845763 1:159262955-159262977 TACTCAAAAAATTCTTCCTGTGG + Intergenic
915934186 1:160081265-160081287 TCCTAAGAAGCTCCTTCCTGGGG - Intergenic
918843866 1:189583298-189583320 TACTGGGAAGCTGCTTCCTGAGG - Intergenic
919193291 1:194251171-194251193 TATCAAGAAGCTTATTCCTTAGG - Intergenic
921186160 1:212671318-212671340 TGCACAGAAGCTGCTTCATGAGG + Intergenic
922249691 1:223837413-223837435 TATCCACAAGCTCCTTCCTATGG - Intronic
1065293750 10:24255703-24255725 TTCCCAGTCGCTTCTTGCTGAGG + Intronic
1065980194 10:30887306-30887328 GACCCAGGTGCTTCTCCCTGTGG + Intronic
1068706188 10:60078682-60078704 AATCCAGAATCTTTTTCCTGGGG + Intronic
1068965774 10:62911045-62911067 GTCTCTGAAGCTTCTTCCTGAGG + Intronic
1069624633 10:69860214-69860236 TACCCTGACACTTCGTCCTGAGG - Intronic
1069989078 10:72303509-72303531 GAGCCTGGAGCTTCTTCCTGGGG + Intergenic
1070104040 10:73414904-73414926 TACCCAAAAGCTTCCTCATGGGG + Intergenic
1072311330 10:94158246-94158268 TACCCAGCAGCATAGTCCTGAGG - Intronic
1073306811 10:102509327-102509349 TATCCAGAGCCTTATTCCTGAGG + Intronic
1073570950 10:104580829-104580851 TACCTGGATGCCTCTTCCTGGGG + Intergenic
1074414539 10:113255680-113255702 TGTGCAGAACCTTCTTCCTGCGG - Intergenic
1074562080 10:114543845-114543867 TTCCCAGAACCCTCTTCCTCGGG + Intronic
1076456820 10:130605665-130605687 TAGCCAGACTCTGCTTCCTGTGG - Intergenic
1077325891 11:1963963-1963985 TACCCATGAGCAGCTTCCTGGGG + Intronic
1077725598 11:4672015-4672037 TGCCCATAATCTTCTTCCTGGGG - Intergenic
1078509351 11:11974033-11974055 TCCCCAGCAGCCTCTTCCTTTGG - Intronic
1083291941 11:61695423-61695445 TCCCCAGAAGCTCCTGCCTAAGG + Intronic
1086401088 11:86461423-86461445 AACTCAGAATCTTCTTCCAGGGG - Intronic
1086575709 11:88337395-88337417 CACCCACAAGCGTCTGCCTGGGG + Intronic
1087012171 11:93524618-93524640 TCCCCATAAGCTACTTCCAGGGG - Intronic
1087602629 11:100336186-100336208 AACCCATAATCTTCTTTCTGGGG + Intronic
1088211006 11:107456200-107456222 TACAGAGATGATTCTTCCTGAGG - Intronic
1088624746 11:111721824-111721846 TGCTGAGAAACTTCTTCCTGAGG - Exonic
1089469202 11:118707287-118707309 TAACCAGCATCTTCTTCATGTGG - Intergenic
1089775638 11:120833568-120833590 CCCCCAGAAGCTTCTACCTGGGG - Intronic
1090094870 11:123732772-123732794 TACTCCAAAGCTTCTTCCTATGG + Intronic
1090726851 11:129535043-129535065 TACTCATAATCTTCTTCCTTGGG + Intergenic
1202808871 11_KI270721v1_random:19142-19164 TACCCATGAGCAGCTTCCTGGGG + Intergenic
1094834376 12:34315418-34315440 TTCCCAGCAGCTCCTGCCTGGGG - Intergenic
1095421157 12:42025219-42025241 TACCCAGAGGCAGCTTCCTTTGG + Intergenic
1097069775 12:56346459-56346481 CACCCAAAAGCTTCATCCCGGGG + Exonic
1100041598 12:90325955-90325977 TTCTCAGAAGCTTCTGCCTCTGG - Intergenic
1102380922 12:112466277-112466299 TACCTAGAATGTTCTCCCTGAGG - Intronic
1102401974 12:112637802-112637824 TCCCCAGAAGCTTCTGCCTTCGG - Intronic
1104204528 12:126625406-126625428 CACTCAGAAGCTCCTTACTGCGG - Intergenic
1107061579 13:36165274-36165296 TACCCTGAAGTTTCTTCCAGTGG + Intergenic
1108178508 13:47818762-47818784 TCCACAGATGCTACTTCCTGGGG - Intergenic
1108948320 13:56052779-56052801 TACCCAGAAAATATTTCCTGGGG + Intergenic
1109725304 13:66332709-66332731 TGCCCAGAATGTCCTTCCTGTGG - Intronic
1113011757 13:105775431-105775453 TACCCAGGAGGATCTTTCTGGGG + Intergenic
1114002059 14:18265478-18265500 TTCCCAGAAACTTCTTTATGAGG - Intergenic
1114235867 14:20823275-20823297 TCCAGAGAAGCTTCTTCCTTTGG - Intergenic
1114952795 14:27778067-27778089 TACCCAGAACATTCTTTCTTAGG - Intergenic
1117766336 14:59087230-59087252 TCCACATAAGGTTCTTCCTGGGG - Intergenic
1121720460 14:96105274-96105296 CACCCAGCATCTTCTTCCTCTGG + Intergenic
1121828262 14:97028249-97028271 TACTCAAAAGCTGCTTGCTGAGG + Intergenic
1124225291 15:27888128-27888150 TGCCCAGATGTCTCTTCCTGTGG - Intronic
1124592101 15:31062665-31062687 TAACTAGAAGCTGCTCCCTGAGG + Exonic
1125251560 15:37711182-37711204 TTCTAATAAGCTTCTTCCTGGGG - Intergenic
1126125977 15:45294623-45294645 TACTCAGAAGGTACTTCTTGTGG - Intergenic
1126574469 15:50183494-50183516 TCCCCAGTATCTTCTCCCTGGGG - Intronic
1127624464 15:60766702-60766724 CTCCCAGGAGCTTCTTGCTGGGG + Intronic
1130578624 15:85115567-85115589 TACCAAGAAACTTCTTAATGAGG - Intronic
1130717227 15:86346796-86346818 CAAGCACAAGCTTCTTCCTGTGG - Intronic
1132395553 15:101471080-101471102 TACTGGGAAGCTTCTCCCTGGGG + Intronic
1133116852 16:3582386-3582408 TGCCCTGGAGCTTCTCCCTGCGG + Exonic
1135029127 16:19023795-19023817 TTCACTGAAGCTTCTTTCTGTGG - Intronic
1137096278 16:36312185-36312207 TCCTCAGAAGCTTCTTTATGAGG + Intergenic
1137096915 16:36320485-36320507 TCCTCAGAAGCTTCTTTATGAGG + Intergenic
1137508754 16:49079821-49079843 TTTACAGAAGCTTCTTCATGGGG - Intergenic
1137715661 16:50596868-50596890 TACCCGGAAGACTCTTCCTCTGG - Intronic
1139651199 16:68363138-68363160 TACCCAGCAGCTCTTTCATGGGG + Intronic
1141331315 16:83113903-83113925 AACCCAGAGGCTTCATCCTTTGG + Intronic
1141412515 16:83845224-83845246 TGCCCAGACACTTCTGCCTGTGG + Intergenic
1142470717 17:161850-161872 TCCCCTGAAGGTGCTTCCTGGGG - Intronic
1142696935 17:1639003-1639025 TACCCAGAAGCTTCTTCCTGGGG + Intronic
1144792401 17:17867775-17867797 TACCCAGATCATTCCTCCTGGGG - Intronic
1145680526 17:26585332-26585354 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145681779 17:26603241-26603263 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145681944 17:26605621-26605643 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682448 17:26612769-26612791 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682613 17:26615149-26615171 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145682816 17:26618154-26618176 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1145683157 17:26622914-26622936 TTCTCAGAACCTTCTTCGTGAGG + Intergenic
1146399463 17:32491871-32491893 TCCCCATAACCCTCTTCCTGAGG - Intergenic
1146524667 17:33556091-33556113 TTCCCAGCAGCTTCATCATGAGG + Intronic
1150027053 17:61687816-61687838 TACCTGGCTGCTTCTTCCTGGGG + Intronic
1151852075 17:76696895-76696917 TACGCAGCTGATTCTTCCTGAGG + Intronic
1152267014 17:79301100-79301122 TAGCCAGAGGCTTCTCCCTGGGG - Intronic
1152433736 17:80262955-80262977 TGCCCTGAGGCTTCTTACTGGGG + Intronic
1153252865 18:3139993-3140015 TATTCAGAACCTTCTTCCTGTGG + Intronic
1158511579 18:58095278-58095300 TATTCAGCAGCTTCTTACTGAGG + Intronic
1158829228 18:61259696-61259718 TACAGAGAAGCTTTTTCCTCAGG + Intergenic
1159602466 18:70441761-70441783 TGCCCAGTAGCTTCTTCCTGGGG - Intergenic
1160708799 19:541333-541355 TCCCCAGGACCTGCTTCCTGGGG - Exonic
1161046377 19:2136924-2136946 TTCCCACACGCGTCTTCCTGTGG - Intronic
1161761160 19:6173608-6173630 TACGCCGCAGCTTCTTCCTGTGG + Intronic
1162267394 19:9586972-9586994 TATCCACAGGCTTCTACCTGTGG + Intergenic
1162272287 19:9626075-9626097 TATCCACAGGCTTCTACCTGTGG + Intronic
1162279196 19:9681398-9681420 TATCCACAGGCTTCTACCTGTGG + Intergenic
1164124957 19:22304878-22304900 TTCCCAGAAACTACTTCCTTTGG - Intronic
1164175269 19:22768188-22768210 TTCCCAGAAACTACTTCCTTTGG + Intronic
1164514061 19:28919164-28919186 CACCCAGAAGCTTTCTCCTGTGG + Intergenic
1167568650 19:50272796-50272818 TACCCAGGAGCTTCTGACTTGGG - Intronic
925567243 2:5269573-5269595 GACCCAGCAACTTCTTCCTTGGG + Intergenic
926079272 2:9970896-9970918 TACCAAGAAGCTTTTCCATGAGG + Intronic
927119337 2:19940668-19940690 AGCCCAGATGCTTCTTCCTTTGG + Intronic
930754428 2:54960496-54960518 CACCCAGCTGGTTCTTCCTGGGG - Intronic
932093041 2:68823685-68823707 CACCCCGAAGCTTCTTACTCAGG - Intronic
933196466 2:79395602-79395624 TACCAAGAGTCTTATTCCTGGGG - Intronic
933662547 2:84939554-84939576 TATCCAGATCCTTCTACCTGGGG + Intergenic
934404925 2:93290399-93290421 TTCCCAGAAACTTCTTTGTGAGG + Intergenic
934451649 2:94042519-94042541 TTCCCAGAAACTTCTTTGTGAGG + Intergenic
934472168 2:94557796-94557818 TTCCCAGAAACTTCTTTGTGAGG - Intergenic
934777631 2:96949392-96949414 TAACCAGATTCTCCTTCCTGAGG + Intronic
936638443 2:114285564-114285586 AACCCAAATCCTTCTTCCTGTGG + Intergenic
937034469 2:118769453-118769475 TGTCAAGAAGGTTCTTCCTGAGG - Intergenic
938533483 2:132218314-132218336 TTCCCAGAAACTTCTTTTTGAGG + Intronic
939685649 2:145196411-145196433 TCACGAGAAGCTACTTCCTGAGG - Intergenic
942364628 2:175211670-175211692 TACTCAGAAGTTTCTGCCTCTGG + Intergenic
942961016 2:181829823-181829845 GACCCAGACCCTTCTCCCTGAGG + Intergenic
943557078 2:189419077-189419099 TTCTCAGAATCATCTTCCTGAGG - Intergenic
943963855 2:194304942-194304964 TCCCCTGATGCTTCTACCTGAGG - Intergenic
944564292 2:200971669-200971691 TACCCAGCAGCTTTTTTGTGTGG + Intergenic
946046539 2:216826161-216826183 TTCCCAGAAGGTTCCTCCTGCGG + Intergenic
948008800 2:234634053-234634075 TCACCAGAAGCTGCCTCCTGGGG - Intergenic
948291132 2:236825806-236825828 TACCCAGAACCCCCTTTCTGGGG + Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1169280486 20:4262918-4262940 TGGCCAGAAGCTTCTTTCAGAGG + Intergenic
1171448641 20:25221558-25221580 TCACCAGAAGCTTCCTCCTGAGG + Intronic
1171577377 20:26345844-26345866 TACTCAGAAACTTCTTTGTGAGG + Intergenic
1172148698 20:32775558-32775580 CACCCACAAGCTTCTCCCCGAGG - Intronic
1172633965 20:36396930-36396952 TTCCCAGAAACTCCTCCCTGGGG - Intronic
1173102870 20:40103774-40103796 TACCCAGCAGCTGCATACTGTGG - Intergenic
1173208331 20:41012239-41012261 GAAGCAGAAGCTTCTTCCTACGG - Intergenic
1173225041 20:41157643-41157665 AACTGAGAAGCTCCTTCCTGTGG - Intronic
1175168865 20:57065751-57065773 AACTGAGAAGCTTCTTCATGTGG + Intergenic
1175815256 20:61880249-61880271 CACCCAGAGGCATCTGCCTGGGG + Intronic
1176083229 20:63284417-63284439 TTCTCAGCAGCTTCTTCCTATGG + Intronic
1176313118 21:5165124-5165146 TCCTCAGAAGCTTCTGGCTGGGG + Intergenic
1176377673 21:6094486-6094508 AACCCTGCAGCTTCTTCATGTGG - Intergenic
1176763915 21:12995706-12995728 TTCTCAGAAACTTCTTTCTGAGG - Intergenic
1178588923 21:33893010-33893032 TTCCCTGCAGCTTCCTCCTGGGG + Exonic
1179745801 21:43443758-43443780 AACCCTGCAGCTTCTTCATGTGG + Intergenic
1179843930 21:44096906-44096928 TCCTCAGAAGCTTCTGGCTGGGG - Intronic
1180426565 22:15196270-15196292 TTCCCAGAAACTTCTTTATGAGG - Intergenic
1181134965 22:20758769-20758791 TACAGAGAAGCCTCTTCCAGAGG - Intronic
1181614127 22:24040405-24040427 CACCAAGAAGCTCTTTCCTGGGG - Intronic
1182190394 22:28454038-28454060 TACCTGGAATATTCTTCCTGAGG + Intronic
1184492178 22:44816036-44816058 TCCCCAGAGGCTTCATCCTAGGG - Intronic
1185139674 22:49093309-49093331 CACCCAGAAGCTTCTCCCACAGG - Intergenic
1202735096 2_KI270716v1_random:137658-137680 TTCCCAGAAACTTCTTTGTGAGG + Intergenic
1202735968 2_KI270716v1_random:151248-151270 TTCCCAGAAACTTCTTTGTGAGG + Intergenic
950121200 3:10483573-10483595 TACCTGGAAGCCTCTTACTGGGG + Intronic
951710013 3:25577631-25577653 TACCCAGGAGCTGCCTCCAGTGG + Intronic
951789441 3:26463433-26463455 TTGCCAGAAGCCTCTACCTGAGG - Intergenic
953239663 3:41137527-41137549 CACCCAGGAGCTTCTACCTGGGG - Intergenic
953452901 3:43018875-43018897 TACGTGGCAGCTTCTTCCTGGGG + Intronic
954114649 3:48459648-48459670 CACCCACAGGCATCTTCCTGGGG + Intronic
954999608 3:54915157-54915179 TAAGCAAAAGATTCTTCCTGTGG + Intronic
958436658 3:94105219-94105241 TCCCCCGAATCTTCTTTCTGTGG + Intronic
958782017 3:98554021-98554043 GACACAGAAGCTACTTCCTTTGG - Intronic
959020360 3:101181924-101181946 TACACAGGAGGTTATTCCTGAGG + Intergenic
960869680 3:122236107-122236129 TAACAAGAAGTTTCTTTCTGAGG + Intronic
961104702 3:124231147-124231169 AGCCCAGAAGCTTCTGCATGTGG + Intronic
961210219 3:125119875-125119897 GGCAGAGAAGCTTCTTCCTGTGG + Intronic
964444444 3:156744085-156744107 TCACCAGAAGCCTCTTCATGCGG + Intergenic
965435504 3:168645745-168645767 TACCAAGAATATTATTCCTGTGG - Intergenic
968921250 4:3523243-3523265 TAGCCAGTCCCTTCTTCCTGGGG + Intronic
969210605 4:5684375-5684397 TACCCTGCAGCCTCCTCCTGAGG - Intronic
973084601 4:46041175-46041197 TACCCATAATCATCTTCTTGCGG + Exonic
974237936 4:59206433-59206455 TAATAAGAAGCTTATTCCTGGGG + Intergenic
976791924 4:88888338-88888360 TTCCCAGAATCTTCTGCCAGTGG + Intronic
977274196 4:94955436-94955458 TACAGAGAAGAGTCTTCCTGTGG + Intronic
978028784 4:103912356-103912378 TACCCTGAAGAATATTCCTGGGG + Intergenic
978031512 4:103943522-103943544 TACCCAGAAGCCACTCCCAGAGG + Intergenic
984095206 4:175425843-175425865 TATTCAGAAGCTTTTTCCTTAGG - Intergenic
985763325 5:1763067-1763089 AACCCAGCAGGTGCTTCCTGAGG - Intergenic
986413252 5:7502890-7502912 TCCCTAGAAAGTTCTTCCTGAGG + Intronic
987351542 5:17026493-17026515 TCCCCAGAAGCTTCTACCATAGG + Intergenic
987814486 5:22882683-22882705 ATCCCAGAATCTACTTCCTGGGG + Intergenic
996521962 5:124437200-124437222 TCCCCAGAAGCTGCATCCTCAGG - Intergenic
996706383 5:126502447-126502469 TACCCAGAAGCTGCTGGCTTAGG - Intergenic
997391318 5:133519434-133519456 AACCCAGCACCTGCTTCCTGAGG - Intronic
997565976 5:134886697-134886719 CACACAGCAGCTCCTTCCTGAGG - Intronic
997926146 5:138032880-138032902 GGCCGAGAAGCCTCTTCCTGGGG + Exonic
999125153 5:149240863-149240885 CACCAAGAAGCTGGTTCCTGAGG + Intronic
999622847 5:153490289-153490311 TTCCCAGCAGCTTCAGCCTGGGG + Intronic
1000330842 5:160204158-160204180 TACCCACAGGGTTCTTGCTGTGG + Intronic
1001253904 5:170169230-170169252 CAGCCAGAAGCTTGCTCCTGTGG - Intergenic
1001282983 5:170401192-170401214 GTCCCAGGAGCTACTTCCTGTGG + Intronic
1001745989 5:174092550-174092572 TACCCAGTGGCTTCGTGCTGAGG + Intronic
1002426386 5:179178831-179178853 TTTCCAAAAGCTTCTTCCTTGGG - Intronic
1005809377 6:29504502-29504524 TCTCCTGAAGCTTCTTGCTGTGG - Intergenic
1006293564 6:33159368-33159390 TACACAGAAACTTATTTCTGAGG + Intergenic
1006981363 6:38150893-38150915 TACCTGGAAGCTTGCTCCTGTGG + Intronic
1007228358 6:40330427-40330449 TACCCAGAGCTTCCTTCCTGGGG - Intergenic
1007697112 6:43740862-43740884 TTCCCAGAAGCTGTGTCCTGGGG - Intergenic
1008483793 6:52013880-52013902 TCCCCTGAAGTTGCTTCCTGTGG + Intronic
1009392418 6:63160550-63160572 TTCCCAGAGGCATCCTCCTGTGG + Intergenic
1010608615 6:77924602-77924624 TAGCAAGAAGCCTATTCCTGTGG - Exonic
1011669430 6:89668762-89668784 TACACAGAAACAGCTTCCTGCGG + Intronic
1012995383 6:105967664-105967686 TACCCAGCAGTCTCTTTCTGTGG + Intergenic
1015298707 6:131628479-131628501 AACCCAGAAGCTGCAGCCTGCGG + Exonic
1017828517 6:158102075-158102097 GACCCAACAGCTTCTTCCTGAGG + Intergenic
1019594214 7:1850910-1850932 TGCCCGGAAGCTGCTTCCTATGG - Intronic
1019911246 7:4101731-4101753 ACCCCAGAAGCGTCTGCCTGTGG + Intronic
1020539888 7:9448212-9448234 TACACAGTATCTTCTTCCTATGG - Intergenic
1021617419 7:22517381-22517403 TCCCCACTAGCTTCTTACTGTGG + Intronic
1022108274 7:27212436-27212458 TAACCAGCAGCTTCTTCCTCTGG + Intergenic
1022927007 7:35066795-35066817 TCCCCACTAGCTTCTTACTGTGG + Intergenic
1024611890 7:51073214-51073236 TACCCAGAATTTACTTCCTTTGG - Intronic
1024773028 7:52747202-52747224 TTCCCATAAGATTGTTCCTGTGG - Intergenic
1028375255 7:90138728-90138750 TCCCCACTAGCTTCTTACTGTGG - Intergenic
1028498124 7:91485113-91485135 ATCACAGAAGCTTCTTCATGAGG + Intergenic
1029050417 7:97680955-97680977 TACACAGAAGGTTATTCCTGAGG + Intergenic
1031468913 7:122146039-122146061 TACCCAGATGCTTAATCCTTAGG - Intergenic
1032388134 7:131538533-131538555 TATCTAGAAGCTTCCTGCTGAGG - Intronic
1032413996 7:131722294-131722316 TACCTTGAAGCTGCTTCTTGGGG + Intergenic
1036960516 8:13240105-13240127 TACGCTGAAGTTTGTTCCTGTGG - Intronic
1039352445 8:36777929-36777951 TTCCGAGAAGCTTCTTTTTGAGG - Intergenic
1039784397 8:40819785-40819807 TACTCAGTACCTTCTTCCTTTGG + Intronic
1040072100 8:43196652-43196674 TGCTCAGGAGCCTCTTCCTGCGG + Intronic
1046059774 8:109124382-109124404 AACCCAGATGCTTCTTCATGAGG - Intergenic
1047995081 8:130327018-130327040 TACTCAGATGCTGCCTCCTGGGG - Intronic
1048541818 8:135348932-135348954 TCCCCAGTGGCTTCTTACTGAGG + Intergenic
1049708992 8:144055296-144055318 AACCCAGCAGCTTTTTCCTGGGG + Intronic
1050665530 9:7932151-7932173 CAGCCAGAAGATTCTACCTGTGG - Intergenic
1052333582 9:27297095-27297117 TACCCAGAGCCTCCTTTCTGTGG + Exonic
1052841345 9:33293695-33293717 TACCAAGAAGCATCTTCTGGGGG + Intronic
1056571779 9:87823421-87823443 CACCCAGTTGCTTATTCCTGTGG + Intergenic
1057457649 9:95228807-95228829 TGCCCAGCAACTCCTTCCTGGGG - Intronic
1058181276 9:101803141-101803163 TACCCAGAAGTTTCTTATTTTGG - Intergenic
1060734833 9:126060186-126060208 AACCCTGCAGCTTCTCCCTGGGG - Intergenic
1061117847 9:128625936-128625958 CCTCCAGAAGCTTCTTCTTGCGG - Exonic
1062049389 9:134439266-134439288 TTCCCAGTGGCTGCTTCCTGGGG + Intronic
1203404948 Un_KI270529v1:217-239 TCCTCAGAAGCTTCTTTATGAGG - Intergenic
1189288079 X:39866332-39866354 TACCAGGAAACTTATTCCTGAGG + Intergenic
1190357385 X:49618403-49618425 TGCCCAGAAGGACCTTCCTGGGG + Intergenic
1192005967 X:67212729-67212751 TGCCAAAAAGCTTCTCCCTGAGG + Intergenic
1193769719 X:85574425-85574447 CACGCAGGAGCTTATTCCTGAGG + Intergenic
1194429353 X:93781910-93781932 TACCAAGAACTTTCTTCCTTTGG - Intergenic
1196016025 X:110941349-110941371 TTCCTAGTAGCTTCATCCTGAGG - Intergenic
1196706441 X:118721395-118721417 TACACAGGAGCATGTTCCTGGGG - Intergenic
1196925448 X:120629750-120629772 GACCGAGAGTCTTCTTCCTGGGG - Intronic
1197368198 X:125593506-125593528 AACTCAGAATCTTATTCCTGAGG - Intergenic
1197442518 X:126509659-126509681 TACCCAGAATTTTCTACCTTTGG + Intergenic
1198004373 X:132477468-132477490 TTCCCAAAAGTCTCTTCCTGTGG - Intronic
1198190216 X:134296628-134296650 AACCCAGAATCTTCTTCAGGAGG + Intergenic
1199697533 X:150353366-150353388 AACCCAGAATCTTGTTCATGGGG + Intergenic
1199833204 X:151563774-151563796 TACCTTGAAGCTCCTCCCTGTGG - Exonic
1199888057 X:152042919-152042941 TACTCAGAATTTTATTCCTGAGG - Intergenic
1200058235 X:153472570-153472592 TTTCCAGAAGCTTCTACCTCTGG - Intronic
1201385881 Y:13439182-13439204 TACATTAAAGCTTCTTCCTGTGG - Intronic