ID: 1142697050

View in Genome Browser
Species Human (GRCh38)
Location 17:1639580-1639602
Sequence GGAAAGGCGGGCCCTTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142697050_1142697062 21 Left 1142697050 17:1639580-1639602 CCATGTGAAGGGCCCGCCTTTCC 0: 1
1: 0
2: 2
3: 11
4: 185
Right 1142697062 17:1639624-1639646 CTTCTTCCACCTTACCTGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 185
1142697050_1142697063 25 Left 1142697050 17:1639580-1639602 CCATGTGAAGGGCCCGCCTTTCC 0: 1
1: 0
2: 2
3: 11
4: 185
Right 1142697063 17:1639628-1639650 TTCCACCTTACCTGGCTGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 171
1142697050_1142697060 17 Left 1142697050 17:1639580-1639602 CCATGTGAAGGGCCCGCCTTTCC 0: 1
1: 0
2: 2
3: 11
4: 185
Right 1142697060 17:1639620-1639642 CAGCCTTCTTCCACCTTACCTGG 0: 1
1: 0
2: 1
3: 14
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142697050 Original CRISPR GGAAAGGCGGGCCCTTCACA TGG (reversed) Intronic
903234105 1:21938342-21938364 GGCAAGGCGGGCAGATCACAAGG - Intergenic
904065426 1:27746486-27746508 GCCAAGGCGGGCGCATCACAAGG + Intronic
905522914 1:38614069-38614091 AGAAAGCCGCGGCCTTCACAAGG + Intergenic
906101661 1:43267762-43267784 GGAAAGGCAGGCTCTTCACAGGG - Intronic
906566421 1:46804296-46804318 GGAGAGGTGGGGCCATCACAAGG + Intronic
907248539 1:53122987-53123009 GGGAAGGAGGGACCTTCAGAGGG - Intronic
907342774 1:53748659-53748681 GCCAAGGCGGGCAGTTCACAAGG + Intergenic
910945966 1:92592007-92592029 GCCAAGGCGGGCGGTTCACAAGG + Intronic
912168475 1:107068932-107068954 GCCAAGGCGGGCCGATCACAAGG + Intergenic
914193744 1:145432680-145432702 GCAAAGGCGGGCGCATCACGAGG - Intergenic
916715524 1:167443832-167443854 GGAGAGGAGGGTCCTACACAGGG - Intronic
918077165 1:181179286-181179308 GCAAAGGCGGGCAGATCACAAGG - Intergenic
919792358 1:201300337-201300359 AGAAAGGAGGGCCCCTCCCAAGG - Intronic
922709944 1:227819854-227819876 GCCAAGGCGGGCGGTTCACAAGG + Intronic
1064601374 10:16997199-16997221 GCAAAGGCAGGCCGATCACAAGG + Intronic
1065130277 10:22613256-22613278 GGAAATGCTGGCACTGCACAGGG + Intronic
1068037922 10:51784064-51784086 GCAAAGGAAGGCCTTTCACAAGG - Intronic
1069160765 10:65090076-65090098 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1069615460 10:69803489-69803511 GGAAAGGCTGGGCCTTGACAGGG + Intronic
1071366694 10:84907624-84907646 GGAAAGGCTGGCCCCTCTCTGGG - Intergenic
1072015069 10:91338439-91338461 GGAAACAGGGACCCTTCACAAGG - Intergenic
1074418160 10:113285377-113285399 GGACAGGCGGGACCTTGACAAGG + Intergenic
1075651325 10:124129692-124129714 GGAAAGGCCAGGCCTGCACAGGG + Intergenic
1078545862 11:12246459-12246481 GGGCAGGGGGGCCCTTCACTGGG + Intronic
1080419939 11:32100818-32100840 GAAAAGGCTGGCCCTACACAAGG + Intronic
1080638787 11:34146445-34146467 GGAAAGGAGGGCCCTGGACTGGG - Exonic
1081181819 11:39993071-39993093 GGAGAAGCAGGCACTTCACATGG - Intergenic
1081810029 11:45909409-45909431 TGAGAGGCTGGCTCTTCACAGGG + Intergenic
1082287541 11:50333803-50333825 GGAAAGGTGCGCTCTTCAAAAGG - Intergenic
1090006488 11:123007348-123007370 GGAAAGGCTGGCCCTGCACTTGG + Intergenic
1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG + Intergenic
1091826414 12:3516082-3516104 GGCAGGGTGGGCCATTCACATGG + Intronic
1092459363 12:8672781-8672803 GCAAGGGCAGGCCATTCACATGG - Intergenic
1092829190 12:12427412-12427434 GCCGAGGCGGGCCCATCACAAGG - Intronic
1094696580 12:32825403-32825425 GCCAAGGCGGGCGGTTCACAAGG - Intronic
1095695966 12:45144414-45144436 GGCAAGGCAGTTCCTTCACATGG + Intergenic
1096627089 12:52902620-52902642 GCCAAGGCGGGCCAATCACAAGG - Intronic
1096727837 12:53579298-53579320 GCCAAGGCGGGCAGTTCACAAGG + Intronic
1102253608 12:111404159-111404181 TCAAAGGTGGGCCCATCACATGG - Intergenic
1103797033 12:123510222-123510244 GCACAGGCGGGCCCCCCACATGG - Intronic
1105762031 13:23524211-23524233 GGAAAGGTGGGCTCTTCCCCAGG + Intergenic
1106110405 13:26771941-26771963 GGCAGGGCGGGCCCTTCCCGGGG + Intergenic
1106667185 13:31864176-31864198 GGATAGGCAGACCCTCCACATGG + Intergenic
1107274559 13:38663448-38663470 GGAAAGGCTGCCGCTTCCCAAGG - Intergenic
1107460766 13:40599758-40599780 GGAAAGATGGGCCTTTCAGATGG + Intronic
1107982352 13:45745705-45745727 GGACAGTCAGGCTCTTCACATGG - Intergenic
1112170101 13:96962553-96962575 GGAAAGGCTGACCATTCATATGG - Intergenic
1112580248 13:100672268-100672290 AGAAAGGCGGGCCCTTCTTTTGG + Intronic
1114704435 14:24711023-24711045 GGATAGGATGGCCCTTGACATGG + Intergenic
1115485593 14:33908632-33908654 GGAAGGGCAGCCCCTTCACAAGG + Intergenic
1115561668 14:34588239-34588261 GCTAAGGCGGGCCGATCACAAGG - Intronic
1116078694 14:40145519-40145541 GGCAAGGCGGGCGGATCACAAGG - Intergenic
1118892508 14:69921879-69921901 GGAAAGGGGGCCCCTTCCCTCGG - Intronic
1119347806 14:73940843-73940865 GGAAAGGAGGCCCCTTGGCAGGG + Intronic
1120829423 14:88984873-88984895 GGAAAGCCGGGGTCTTCTCAAGG + Intergenic
1121603966 14:95226999-95227021 GGGAAGGCTGGGCATTCACATGG + Intronic
1121767960 14:96503230-96503252 GGAGAAGGGGGCACTTCACAGGG + Intronic
1122689460 14:103524886-103524908 GGAAAGGGGGTCCTTTCCCATGG - Intergenic
1125362348 15:38877388-38877410 GGAAAGGCAGGGCCATCACTGGG + Intergenic
1125952913 15:43768787-43768809 GCAAAGGCGGGCACATCACAAGG + Intronic
1128388032 15:67164588-67164610 TGAAGTGCGGGCCCTTCCCATGG + Intronic
1131099417 15:89676479-89676501 GCCAAGGCGGGCGGTTCACAAGG - Intronic
1135002736 16:18790441-18790463 GGAAAGGCGGAGCCTCCTCAGGG + Intronic
1137827063 16:51507512-51507534 GCAAAGGCATGCCCTTCTCATGG - Intergenic
1139155378 16:64435080-64435102 AGAAAGGCAGGCCCTTAAGATGG + Intergenic
1140230658 16:73114753-73114775 AGACAGGCTGGCCATTCACAAGG - Intergenic
1141450357 16:84095723-84095745 GGAGAGGCTGGCTCTTCGCAGGG + Exonic
1142348422 16:89568854-89568876 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1142396047 16:89832165-89832187 GAAAAGGATGCCCCTTCACATGG - Intronic
1142697050 17:1639580-1639602 GGAAAGGCGGGCCCTTCACATGG - Intronic
1142772201 17:2106591-2106613 GGAAAGGCTGTCCTGTCACAAGG + Intronic
1144949344 17:18985586-18985608 GGGAAGGCAGGCCCTCGACAGGG + Intronic
1147610750 17:41800777-41800799 GGAGGGGCTGGCCCTTCAGAGGG - Intergenic
1151824455 17:76516165-76516187 GGCAAGGCGGGCGGATCACAAGG - Intergenic
1152014525 17:77741765-77741787 GGAGATGTGGGCCCTGCACAAGG - Intergenic
1153675299 18:7451743-7451765 GAAAAGGCGGGGCCTGCCCATGG + Intergenic
1154191696 18:12235714-12235736 GGAGAGGGGGAACCTTCACAGGG + Intergenic
1155176781 18:23307919-23307941 GGACAGGCAGGCTCTTCAGAAGG - Intronic
1155797568 18:30059442-30059464 GGTAAGGAGGGCACTGCACATGG + Intergenic
1158574629 18:58625757-58625779 GGAAGGGCTGGCCCTTGAGAGGG + Intronic
1160945849 19:1643729-1643751 GAACAGGCAGACCCTTCACAGGG + Intronic
1161041040 19:2110922-2110944 GGGCAGGCGGGCCCGCCACAGGG + Intronic
1163816281 19:19466464-19466486 GGAGAGACAGGCCCTCCACAGGG - Intronic
1163847267 19:19644776-19644798 GCCAAGGCGGGCCCATCACAAGG - Intergenic
1164005844 19:21148227-21148249 GCCAAGGCGGGCCGATCACAAGG - Intronic
1165940917 19:39414313-39414335 GGGAAGGCGGGCCCATCCCCAGG + Intronic
1166079408 19:40434195-40434217 GGAAAGGCTGGCCCTGCAGAAGG - Intergenic
1167066714 19:47191819-47191841 GCCAAGGCGGGCCGATCACAAGG + Intronic
1168343631 19:55640363-55640385 GGAAAGGCTGGCACTGCCCACGG - Intronic
926333555 2:11846406-11846428 GCCAAGGCGGGCCGATCACAAGG - Intergenic
927512350 2:23652065-23652087 GGAAAGGGTAGCCCCTCACAAGG + Intronic
928751429 2:34474971-34474993 GGAGAGGCGGGCAGATCACAAGG + Intergenic
930655642 2:54004642-54004664 GCCAAGGCGGGCCGATCACAAGG - Intronic
931410595 2:62026334-62026356 GGAAGAGCAGGCACTTCACATGG + Intronic
935792220 2:106603062-106603084 GGTAAGGCAGGCACATCACATGG + Intergenic
937158291 2:119737144-119737166 GGAGAGGAGGCCCCTTCACAGGG - Intergenic
938656887 2:133443509-133443531 AGAAAGGAGGGCCCTTCCCATGG - Intronic
939735557 2:145840093-145840115 GCCAAGGCGGGCACATCACAAGG - Intergenic
943547082 2:189293849-189293871 GCCAAGGCGGGCACATCACAAGG + Intergenic
943799185 2:192036426-192036448 GGAAAGGCAGGCCCATGATATGG + Intronic
944236000 2:197441875-197441897 GCCAAGGCGGGCGGTTCACAAGG + Intergenic
946024832 2:216665398-216665420 GGGATGGCGGGCCCTTTACCAGG + Intergenic
946242198 2:218363244-218363266 GCCAAGGCGGGCCGATCACAAGG + Intronic
948699122 2:239749525-239749547 AGAAAGACGGGCCCTGCACGGGG - Intergenic
1169422787 20:5473279-5473301 GGAAAGGGGGTGCCTTGACACGG - Intergenic
1169426638 20:5502196-5502218 GGAAAGGGGGTGCCTTGACACGG + Intergenic
1172155355 20:32820162-32820184 GGAAGGGCGGGGCCGTCACCCGG + Intronic
1172270063 20:33650061-33650083 GGAAAGGTGGTCCCTACACTAGG + Intergenic
1173446870 20:43127187-43127209 GCAAAGGCGGGCGGATCACAAGG + Intronic
1173792831 20:45839279-45839301 GCAAAGGCGGGCGGATCACAAGG + Intronic
1175364323 20:58441405-58441427 GCCAAGGCGGGCCGATCACAAGG + Intronic
1178517906 21:33264281-33264303 GAGAAGGGGGGCCCTGCACAAGG + Exonic
1179178124 21:39023246-39023268 GAAAAGGCAGGCCCCTCCCAAGG + Intergenic
1181183617 22:21085248-21085270 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1181952632 22:26565383-26565405 GGAGAGGCAGGCCCATCGCAAGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183799313 22:40148514-40148536 GGCAAGGCGGGCAGATCACAAGG - Intronic
1184447591 22:44559196-44559218 GGAGAGGCAGGCACCTCACATGG + Intergenic
1184489490 22:44800745-44800767 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489500 22:44800778-44800800 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489510 22:44800811-44800833 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489530 22:44800877-44800899 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489540 22:44800910-44800932 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489550 22:44800943-44800965 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489560 22:44800976-44800998 GGAGAGGCGGCCCCCACACACGG - Intronic
1184489570 22:44801009-44801031 GGAGAGGCGGCCCCCACACACGG - Intronic
1184858534 22:47160307-47160329 GCAAGGGAGGGCCCCTCACACGG - Intronic
1185205928 22:49538738-49538760 GGTGAGGAGGGCCCTTCTCAGGG + Intronic
949165655 3:938074-938096 GTAAAGGCTGGCCCTTCAGCTGG + Intergenic
950506003 3:13395001-13395023 GCAAAGGTGGGGCCTTGACATGG + Intronic
951205596 3:19923031-19923053 GCAAAGGCGGGCGGATCACAAGG + Intronic
952369177 3:32703156-32703178 GCCAAGGCGGGCACATCACAAGG - Intronic
955125415 3:56106185-56106207 GAACAGGCAGGCCCTTCTCAAGG - Intronic
956754096 3:72368392-72368414 GAAAAGGCTGGCCCTCCCCAGGG - Intergenic
957514198 3:81230266-81230288 GCCAAGGTGGGCCCATCACATGG - Intergenic
960997939 3:123351854-123351876 GGGAAGGCAGGCCATTCCCAGGG - Intronic
961677030 3:128573944-128573966 GGAAAGACAGGCCCTTCACAGGG + Exonic
962379765 3:134888473-134888495 GCAGAGGCGGGCACATCACAAGG + Intronic
962579975 3:136789431-136789453 GCCAAGGCGGGCACATCACAAGG + Intergenic
963056271 3:141188632-141188654 GAAATTGCGGGCCCTTCACTGGG - Intergenic
964903435 3:161689373-161689395 GGCAAGGCGGGCGGATCACAAGG + Intergenic
970671004 4:18396679-18396701 GGAAAGGAGGGGCCTGCGCAGGG - Intergenic
975223410 4:71840621-71840643 GGATAGGCTGGCCCTTCATGGGG - Intergenic
977071417 4:92393069-92393091 GTAGAAGCGGGCACTTCACATGG + Intronic
979039360 4:115767065-115767087 GCAAAGGCGGGCGCATCACGAGG - Intergenic
984204707 4:176772626-176772648 TGAAAGGTGGGACCTTCAGAAGG + Intronic
985112259 4:186557641-186557663 GGGAAGGCGGGGCCTTCAAGAGG + Intergenic
986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG + Intergenic
989380566 5:40805782-40805804 GGCAAGGCGGGCGGATCACAAGG + Intergenic
989860706 5:46372116-46372138 GGACAGACGGACACTTCACACGG + Intergenic
993507360 5:88726451-88726473 TGAAAGGAGGTTCCTTCACATGG - Intronic
996731708 5:126723375-126723397 GCCAAGGCGGGCGCATCACAAGG + Intergenic
997810300 5:136961491-136961513 GGAAAGCCAGGACCTTCAAAAGG - Intergenic
999266125 5:150268110-150268132 GGCAAGGCGGGCGGATCACAAGG - Intronic
1005109028 6:22258270-22258292 GGAAAGGGGTGCCCTCCTCAAGG - Intergenic
1005613120 6:27545777-27545799 GGAAAGGCGGGAACTGCACCTGG - Intergenic
1006055347 6:31379837-31379859 AGAAACGCTGCCCCTTCACAAGG - Intergenic
1006411923 6:33878736-33878758 TGAAAGGAGGCCTCTTCACATGG - Intergenic
1009207575 6:60821646-60821668 GCAAAGGCGGGTGCGTCACAAGG - Intergenic
1009574496 6:65434552-65434574 GCCAAGGCGGGCCGATCACAAGG - Intronic
1010123915 6:72411120-72411142 GGAAAGTGTGGCCCGTCACAAGG - Intergenic
1010461745 6:76121346-76121368 GCAAAGGCGGGCGGATCACAAGG - Intergenic
1011540677 6:88424600-88424622 GGAGGGGCAGGCACTTCACATGG - Intergenic
1012448625 6:99331762-99331784 GGAAAGGAAGGACCTGCACAAGG - Intronic
1013408389 6:109862572-109862594 GCCAAGGCGGGCCGATCACAAGG + Intergenic
1013637816 6:112045924-112045946 GGACAGGCAGGTCCTTCAGAAGG + Intergenic
1016924404 6:149328524-149328546 GTCAAGGCGGGCCAATCACAAGG - Intronic
1017019906 6:150131637-150131659 GGAGAAGCAGGCACTTCACATGG - Intergenic
1017485208 6:154896079-154896101 GGAAAGGCCGACCCTTTACCCGG - Intronic
1017687834 6:156930954-156930976 GCCAAGGCGGGCAGTTCACAAGG + Intronic
1017889764 6:158628656-158628678 GGACAGGCTGCCCCTTCCCACGG - Intronic
1018998357 6:168727084-168727106 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1019217572 6:170453708-170453730 GGACAGGCGGTGCCTTCACCGGG - Intergenic
1021692919 7:23247814-23247836 GGAAAGGAAGTCCCATCACAGGG + Intronic
1023676287 7:42633594-42633616 GGAAAGGAGGGGTCATCACATGG - Intergenic
1025114497 7:56246072-56246094 GGGAATGCAGGCACTTCACATGG + Intergenic
1027719431 7:81721009-81721031 GCCAAGGCGGGCCCATCACGAGG + Intronic
1029005170 7:97201787-97201809 GGAAAGAGAGGCCCTTCCCAAGG + Intergenic
1029628223 7:101733830-101733852 GCAGCGGCGGGCCCCTCACAAGG - Intergenic
1033665073 7:143433047-143433069 GGCAAGGCGGGCAGATCACAAGG - Intergenic
1035892060 8:3356440-3356462 GCCAAGGCGGGCACATCACATGG + Intronic
1036162679 8:6404474-6404496 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1037177459 8:15963758-15963780 GGCAAGGCGGGCAGATCACAAGG + Intergenic
1037236214 8:16721948-16721970 GGAGAGGCAGGGCCTTCACAAGG - Intergenic
1037290605 8:17345701-17345723 GGAAAGATGGACCCTCCACAGGG + Intronic
1039977940 8:42383219-42383241 GGTAAGGCCAGCCCTCCACAAGG + Intergenic
1039989785 8:42477703-42477725 GCCAAGGCGGGCAGTTCACAAGG - Intronic
1042522847 8:69732654-69732676 GGAGAGGCGGGCAGATCACAAGG + Intronic
1043421308 8:80101657-80101679 GGGAAGGCAGGCGCATCACATGG + Intronic
1046195024 8:110851350-110851372 GCAAAGGCGGGCGGATCACAAGG - Intergenic
1050186216 9:2977204-2977226 TAACAGGCGGGCCCTTTACAAGG + Intergenic
1050909693 9:11053487-11053509 GGAGAGCCAGGCACTTCACATGG + Intergenic
1057194196 9:93107693-93107715 GGAAAGGCGTGTCCTGCACCAGG - Exonic
1190879792 X:54484010-54484032 GGCAAAGGGAGCCCTTCACAAGG - Intronic
1195896541 X:109751107-109751129 GCCAAGGCGGGCCGATCACAAGG - Intergenic
1196701335 X:118672667-118672689 GCCAAGGCGGGCGCATCACAAGG - Intronic
1200064829 X:153499362-153499384 GGACAGGCTGGACCTTGACATGG + Intronic
1200216911 X:154372000-154372022 GGGAAGGCGGGCCCGTGGCAGGG - Intronic
1200218243 X:154378328-154378350 GGGAAGGCGGGCCCATGGCAGGG + Intergenic