ID: 1142698429

View in Genome Browser
Species Human (GRCh38)
Location 17:1645825-1645847
Sequence CCTGAGAGGGAGGGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1029
Summary {0: 1, 1: 0, 2: 5, 3: 94, 4: 929}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698410_1142698429 22 Left 1142698410 17:1645780-1645802 CCTGAGGAAACCAGGCCGGAGGG 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG 0: 1
1: 0
2: 5
3: 94
4: 929
1142698416_1142698429 7 Left 1142698416 17:1645795-1645817 CCGGAGGGGCGGGCTGCCACGAG 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG 0: 1
1: 0
2: 5
3: 94
4: 929
1142698418_1142698429 -9 Left 1142698418 17:1645811-1645833 CCACGAGGCACCTCCCTGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG 0: 1
1: 0
2: 5
3: 94
4: 929
1142698415_1142698429 12 Left 1142698415 17:1645790-1645812 CCAGGCCGGAGGGGCGGGCTGCC 0: 1
1: 0
2: 1
3: 42
4: 369
Right 1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG 0: 1
1: 0
2: 5
3: 94
4: 929

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698429 Original CRISPR CCTGAGAGGGAGGGGGTGGC TGG Intergenic
900099304 1:954356-954378 TCTGAGAGGGAGTTGGAGGCTGG - Intronic
900149588 1:1172247-1172269 CCTGAGAGGGAGGTGGAGAGAGG - Intergenic
900159159 1:1215350-1215372 CTGGAGAGGGAGGGAGTGGAGGG + Intergenic
900347088 1:2215085-2215107 CCTGACAAGGAGGGGGTGACCGG + Intergenic
900372409 1:2337814-2337836 TCTGAGAGGGAGGCAGGGGCTGG + Intronic
900389952 1:2429456-2429478 CCTGAGAGTGAGGAGTTGGCGGG + Intronic
900409129 1:2504929-2504951 CCGGCTGGGGAGGGGGTGGCAGG + Exonic
900435516 1:2628963-2628985 CCAGGCAGGGAGGGGGTGGGCGG + Intronic
900512355 1:3066702-3066724 CCTGAGCTGGAGGAGGAGGCAGG + Intergenic
900533041 1:3164034-3164056 CTTTAGAGGGAAGGGGTGGCTGG - Intronic
900542766 1:3212365-3212387 CCTGAGTGGGCGGTGGGGGCAGG + Intronic
900579349 1:3400874-3400896 GCTGACAGGGAAGGGGTGTCTGG - Intronic
900609110 1:3536998-3537020 CCTGAGAGGGAGATGATGCCGGG + Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
900902044 1:5523798-5523820 CCAGAGATTCAGGGGGTGGCTGG - Intergenic
901130964 1:6962474-6962496 TCTGAGGGGGCGGGGCTGGCAGG - Intronic
901183167 1:7355731-7355753 CCTGAGAGGGGAGGGGTGGAAGG - Intronic
901251480 1:7783630-7783652 CATTAGAGGGAGGGAGAGGCGGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902211863 1:14910336-14910358 CCTGAGACGGAGGAGTTGGTAGG - Intronic
902255423 1:15186071-15186093 GCTGAGTGGGAGGAGGGGGCAGG - Intronic
902339330 1:15772455-15772477 CATGAGAGGGAGGGGGGAGTGGG + Intronic
902637930 1:17747197-17747219 CCTGGGACTGAGGGGGTGCCTGG + Intergenic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
902835387 1:19043768-19043790 ACTGGGTGGGAGGGGGTGGAGGG + Intergenic
903232648 1:21931356-21931378 CGGGAGCAGGAGGGGGTGGCAGG + Intronic
903435078 1:23343762-23343784 CCTGAGGGGATGGGGGTGGGGGG - Intronic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903954116 1:27013024-27013046 CCTGAGAAGGAGGGCGGGGCAGG - Intergenic
904358712 1:29958803-29958825 CCTGAAAGCGAGGGGAGGGCTGG + Intergenic
904438156 1:30512716-30512738 CCAGGGAGGGTGTGGGTGGCTGG - Intergenic
904468906 1:30723739-30723761 CCTGAGAGGGCGGGAGAGCCTGG + Intergenic
904796246 1:33058427-33058449 CATGAGAGGGTGGGGCTGGAGGG + Intronic
905016489 1:34781917-34781939 ATTGAGAGGTACGGGGTGGCGGG - Intronic
905025663 1:34847703-34847725 CCTGAGAGGGTGGGGTGGGCTGG - Intronic
905202442 1:36323521-36323543 CCCGAGCGGGCGGGGGCGGCCGG - Intronic
905202723 1:36324603-36324625 CCGGACAGGGAGAGGGTCGCTGG - Intronic
905289384 1:36911123-36911145 AGAGGGAGGGAGGGGGTGGCCGG + Intronic
905483799 1:38281398-38281420 GCTGAGAGTGAGGGGGTGAAGGG + Intergenic
905508299 1:38498158-38498180 CCTGAGAGGTGGAGGGTGGGGGG - Intergenic
905657059 1:39691904-39691926 TGGGAGAGGGAGGAGGTGGCTGG + Intergenic
906383029 1:45344877-45344899 CCTGAGGTGGAGAAGGTGGCTGG + Exonic
906528422 1:46509797-46509819 GCGGGGAGGGTGGGGGTGGCAGG - Intronic
906530010 1:46518327-46518349 CATGAGAAGGAGGTGGGGGCAGG + Intergenic
906551294 1:46668330-46668352 CCTGAGGAGGAGGAGGAGGCGGG - Exonic
907110634 1:51923347-51923369 CAGGAGAGGGAGAGGCTGGCAGG + Intronic
907179084 1:52553621-52553643 CCGGAGTGGGTGGGGGTGGCGGG + Intergenic
907272524 1:53299200-53299222 CCTGTGTGGGGAGGGGTGGCGGG + Intronic
907313352 1:53552384-53552406 CCTGAGAAGGAAGGCCTGGCGGG - Intronic
908474590 1:64474921-64474943 CCTGGGAGGGAGGGAGGAGCAGG + Intronic
910237315 1:85048674-85048696 AGTGATAGGGTGGGGGTGGCAGG - Intronic
912117231 1:106421569-106421591 CCTGTGAGGTGGGGAGTGGCGGG + Intergenic
912383933 1:109262007-109262029 GCTGAGAGGAAGGGAGCGGCTGG + Intronic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912775422 1:112503736-112503758 TCAGACAGGGAGGGGGAGGCAGG + Intronic
913174003 1:116257272-116257294 ACTCAGAGGGAGGGAGGGGCAGG - Intergenic
913500871 1:119471609-119471631 CCACAGAGGCAAGGGGTGGCTGG - Intergenic
913505368 1:119512031-119512053 CCTGGGAGGCAAGGGGTGTCTGG - Intronic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914285635 1:146224379-146224401 AATGAGAGGCAGGGGGTGGATGG + Intronic
914546666 1:148675131-148675153 AATGAGAGGCAGGGGGTGGATGG + Intronic
914619897 1:149395536-149395558 AGTGAGAGGCAGGGGGTGGGTGG - Intergenic
915314213 1:155018766-155018788 GAGGAGAGGAAGGGGGTGGCCGG + Intronic
915320609 1:155054025-155054047 GGAAAGAGGGAGGGGGTGGCTGG + Intronic
915461625 1:156073948-156073970 CCTGAGGGGGAGGGGGAGAGGGG + Exonic
915973340 1:160368808-160368830 CCTGAGAGGGAGGGGACCACAGG + Intronic
916548544 1:165828403-165828425 GCCGAGAGGGCGAGGGTGGCGGG + Intronic
917522209 1:175757541-175757563 CCTGAGAGTGGGGAGGCGGCAGG + Intergenic
917836137 1:178942945-178942967 CCTGGGAGGGAAGGGCTGCCAGG + Intergenic
917869474 1:179229197-179229219 CATGAGAGCGTGGGGGAGGCCGG - Intronic
917965503 1:180176083-180176105 CCTGGGAGTGAGAGGGTGGTGGG + Intronic
918055870 1:181022097-181022119 GCTGGGAGGGAGGCGGGGGCGGG - Intronic
918082406 1:181217782-181217804 CCTGGAAGAGAGGGGCTGGCAGG + Intergenic
919152346 1:193717431-193717453 GCTGAGAGGCATGGGGTTGCAGG + Intergenic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
919824812 1:201495967-201495989 CCAGAGCGGGTCGGGGTGGCAGG - Intronic
920051450 1:203167171-203167193 CCTGTGTGGGAGGGCGAGGCGGG + Exonic
920051464 1:203167207-203167229 CCTGTGTGGGAGGGCGAGGCGGG + Exonic
920203036 1:204272120-204272142 CCTGAGAGGAATGGGGTGGGCGG - Intronic
920235412 1:204500084-204500106 CCTGAGCTGGAGGGGGTGAATGG + Intergenic
920353434 1:205352789-205352811 CCAGTGAAGGAGGGAGTGGCAGG + Intronic
920375279 1:205504818-205504840 CCTGGGAGGAAGGGGGAGGTCGG + Intronic
920448859 1:206041754-206041776 CCCGTGAGGGAGGGGGAGGCAGG + Intronic
920495076 1:206448747-206448769 TTTGAGATGGTGGGGGTGGCGGG - Intronic
920943899 1:210510455-210510477 GCTGAGACGGAGGAGGTGGGCGG + Intronic
921047801 1:211489978-211490000 TCTGAGAGTGTGGGGGTGGAAGG - Intronic
921060397 1:211579491-211579513 CGGGAGGGGGAGGGGCTGGCCGG + Intergenic
921799085 1:219381112-219381134 CATGAGAGGGACCGGGTGGGAGG + Intergenic
922448906 1:225720693-225720715 CCTGAGAGACACGGGCTGGCTGG + Intergenic
922499079 1:226083620-226083642 CCTGGGAGAGCGCGGGTGGCTGG - Intergenic
922505260 1:226122261-226122283 CCCGAGAGGCCGGGGGTGGGAGG - Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922740286 1:228010580-228010602 CCTGAGAGGGAGAGCAGGGCTGG - Intronic
922891125 1:229062553-229062575 GCTGGGAGGGAGGGAGTGGCTGG + Intergenic
923429440 1:233905849-233905871 GCAGGGCGGGAGGGGGTGGCTGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
924131037 1:240908583-240908605 CCTGGCAGGGAGGGAGTGGAAGG - Intronic
924615123 1:245606161-245606183 CCTGGGCCAGAGGGGGTGGCAGG - Intronic
924782928 1:247169543-247169565 CCTGAGCAGGATGGGGTGGGAGG - Intronic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063150683 10:3333615-3333637 CCTGAGAGGCAGGAGCTGGTGGG + Intergenic
1063781679 10:9332143-9332165 GCTGGGATGGAGGGGGTGCCTGG - Intergenic
1064086640 10:12350178-12350200 GCGGAGAGGGCGGCGGTGGCAGG - Intronic
1064429403 10:15257920-15257942 TATGATTGGGAGGGGGTGGCAGG + Intronic
1064981984 10:21174243-21174265 CCTGGGAGGGAGGGCGCAGCGGG + Intergenic
1065024274 10:21526210-21526232 CCTGCGAGGGAGGGGAGGGACGG + Intergenic
1065122223 10:22541289-22541311 CCTGAGAGGGAGAGGGCTGTTGG + Intronic
1065186715 10:23175466-23175488 CTTGAGGGGGTGGGGGTGGGGGG - Intergenic
1065600131 10:27359458-27359480 CCTGAGAGGGAGGCCAAGGCGGG + Intergenic
1065902308 10:30219712-30219734 ACAAAGAGGGAGGGAGTGGCCGG + Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1066656111 10:37701201-37701223 CCTGTGAGGCAGAGGGTGGGGGG - Intergenic
1066688417 10:38003085-38003107 CCAGAGTGGCTGGGGGTGGCAGG - Intergenic
1067060432 10:43075565-43075587 CCTGATAGGTAGGGAGGGGCTGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067555550 10:47267399-47267421 TCAGAGAGGGAGGAAGTGGCTGG + Intergenic
1067841213 10:49680768-49680790 CCTGAGAGGATGGAGGTGGGAGG + Intronic
1068707345 10:60091522-60091544 CCAGGGAGGGTGGGGGTGGGAGG + Intronic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1069141357 10:64830060-64830082 CCTGAGAGAGAGAGAGAGGCTGG - Intergenic
1069892884 10:71662860-71662882 TCTGAAATGGAGGGGCTGGCAGG + Intronic
1069961226 10:72080597-72080619 TGTGAGGGGGTGGGGGTGGCTGG + Intronic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1070515980 10:77206806-77206828 GCAGGGAGGGAGGGGGGGGCGGG + Intronic
1070750759 10:78962742-78962764 GAGGGGAGGGAGGGGGTGGCCGG - Intergenic
1070983271 10:80667090-80667112 CCTGAGAGGATGGGGCTGCCTGG + Intergenic
1071357564 10:84813085-84813107 CTTGGTAGGGATGGGGTGGCGGG + Intergenic
1071573702 10:86711458-86711480 CCGGAGAGGGAGGTGGAGGCAGG - Intronic
1072418339 10:95268491-95268513 CCTGCGTGGGAAGGGTTGGCAGG - Intronic
1072492998 10:95927351-95927373 CCTGAGAGTGAGATGGTGGGAGG - Intronic
1072508013 10:96089861-96089883 CCTGGGAGGAAGGGGCGGGCCGG - Intergenic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1073082469 10:100868689-100868711 CCTGGGTTGGGGGGGGTGGCTGG - Intergenic
1073624538 10:105083439-105083461 CTTGAGAGGGAAGAGGTGCCAGG + Intronic
1074146612 10:110722319-110722341 TGTGTGAGGGAGGGGGTGGATGG - Intronic
1074289875 10:112130422-112130444 CTTGCAAGGGAGGGGGTGGCAGG + Intergenic
1075059012 10:119241644-119241666 CCTGAGACAGTCGGGGTGGCTGG + Intronic
1075103463 10:119521914-119521936 CCTGAGAAGGGGGGTCTGGCAGG - Intronic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1075913461 10:126146273-126146295 CCTGTGAGGGAGAGGCAGGCAGG + Intronic
1075960415 10:126563261-126563283 GGTGTGAGGGTGGGGGTGGCAGG - Intronic
1076178041 10:128383696-128383718 CCTGAGAGCCAGTGGGTGGGAGG + Intergenic
1076670822 10:132120308-132120330 CCTGCGGGGGAGGGATTGGCTGG + Intronic
1076698310 10:132257536-132257558 GCTGCGAAGGAGTGGGTGGCAGG + Intronic
1076923189 10:133466131-133466153 CATGAGGGAGAGGGTGTGGCTGG + Intergenic
1077017891 11:404979-405001 CCTCAGGGGCAGGGGGTGCCTGG - Intergenic
1077093496 11:789871-789893 CGGGAGAGGGAGGCGGCGGCCGG - Intronic
1077100629 11:820795-820817 CATGAGAGGGAGGGGGCTGGAGG - Intronic
1077131213 11:973683-973705 CAGGAGAGGGAGGGTGGGGCTGG + Intronic
1077144921 11:1040495-1040517 CCTTGGAGGGAGGGTGGGGCAGG - Intergenic
1077182909 11:1224465-1224487 CCTGGGGGGGAGGGGTTGCCTGG + Intronic
1077337982 11:2013925-2013947 GCTGATGGGGATGGGGTGGCCGG + Intergenic
1077571191 11:3339708-3339730 ACGGAGGTGGAGGGGGTGGCTGG + Intronic
1078020854 11:7654959-7654981 CCTGAGAAGGAGGGGCAGGAGGG + Intronic
1078405991 11:11070377-11070399 ATAGAGAGGGAGGGGCTGGCAGG - Intergenic
1078987064 11:16607082-16607104 CCCGAGAGGGCGCGGGTGGCCGG - Intronic
1079127658 11:17730392-17730414 CATGAGGGGGAGGGGGTGTAAGG + Intergenic
1080248171 11:30203138-30203160 CCTGGGAGGGAGGTGATGGTAGG + Intergenic
1080291400 11:30675120-30675142 CCTGAAAGTGACGGGGAGGCTGG + Intergenic
1080622475 11:33998070-33998092 CCTGAGAGTATGGGGGTGGCAGG + Intergenic
1080657082 11:34266617-34266639 TCTCGGAGGAAGGGGGTGGCAGG - Intronic
1081566620 11:44264669-44264691 GCTGGGAGGGAGGGGGCAGCAGG - Exonic
1081669386 11:44934747-44934769 CCAGGGAGGCAGGGGGTGGGGGG - Exonic
1081681423 11:45008153-45008175 CCAGAGAAGGAGGAGGTAGCTGG - Intergenic
1081787573 11:45757981-45758003 CCTGTAAGTGAGTGGGTGGCAGG + Intergenic
1082570967 11:54739728-54739750 CATGAGAGGGACGAGGTGGGAGG + Intergenic
1082928863 11:58579099-58579121 CTTGAGTGGCAGGGGGTGGGGGG + Exonic
1083297451 11:61722695-61722717 CCTGGGAGGCGGGGGGTGGGGGG + Intronic
1083360553 11:62104468-62104490 AATGAGAGCGAGGGGGTGGGAGG - Intergenic
1083437054 11:62649749-62649771 CATGAGAGGGTGGAGGTGGACGG + Exonic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083621534 11:64051743-64051765 CCTGAGAGGGACTGGGCCGCAGG - Intronic
1083742954 11:64720824-64720846 CCTGGGAGGGATGGGGTGTCTGG + Intronic
1083821052 11:65171596-65171618 CCTGAGAGGGAGAGGGTCAGAGG - Intronic
1084068979 11:66721540-66721562 CCAGAGAGGGACGGGTTTGCGGG + Intronic
1084266304 11:68007120-68007142 ACTGCCAGGGAGGGGGTGGGAGG + Intergenic
1084276559 11:68054291-68054313 CCTGAGAGGCAGGGCTGGGCTGG - Intronic
1084284505 11:68122242-68122264 CCTGCGGGGGATGGGGAGGCAGG - Intergenic
1084415435 11:69029725-69029747 CCTTAGAGGGATGTGCTGGCGGG + Intergenic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1084548479 11:69826298-69826320 ACAAAGAGGGAGAGGGTGGCCGG + Intergenic
1084593567 11:70104452-70104474 CTGGAGGGGGATGGGGTGGCGGG - Intronic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1084785613 11:71440194-71440216 CCTGAGAGGGTAAGGGAGGCCGG + Intronic
1084868543 11:72080275-72080297 CCTGAGAGGGAGGAGCCGGGGGG - Intronic
1085327616 11:75618980-75619002 GCTGAGGGGGAGTGGGTGGGAGG + Intronic
1085496810 11:76978000-76978022 CCAGAGGGGGCGGAGGTGGCAGG - Intronic
1085524515 11:77156637-77156659 CTGCAGAGGGAGGGAGTGGCAGG - Intronic
1085662015 11:78376981-78377003 CTTGAGAGAGTCGGGGTGGCAGG - Intronic
1086455679 11:86956356-86956378 CCTGGTGGGGAGGGGGTGCCCGG - Intergenic
1089204477 11:116748455-116748477 CCTGAGGCTGTGGGGGTGGCTGG - Exonic
1089212682 11:116816571-116816593 CCTAAGAGGGAAGGGGTGTGTGG + Intergenic
1089270747 11:117300030-117300052 CAGGAGAGGAAGGGGGAGGCAGG - Intronic
1089313405 11:117574641-117574663 CTTGAGAGGTAGGGAGTGCCAGG - Intronic
1089500898 11:118930605-118930627 ACTGAGCGGGATGGTGTGGCAGG - Intronic
1089617992 11:119705944-119705966 CCTGAGAGGGAGGCGGGGAGGGG + Intronic
1089633118 11:119795852-119795874 GCAGAGAAGGAGGGGGAGGCAGG + Intergenic
1089654273 11:119935599-119935621 CCTGAGAGGGTTGGGGATGCAGG - Intergenic
1090057337 11:123434490-123434512 CCTGAGAAGGAATTGGTGGCGGG + Intronic
1090414099 11:126528850-126528872 ATGGAGAGGGAGGGGGTGGGTGG + Intronic
1090597436 11:128334827-128334849 CCTGACAACGTGGGGGTGGCGGG + Intergenic
1090610712 11:128467950-128467972 CCTGAGAGGGAGGGTGGAGAGGG - Intronic
1090614184 11:128499982-128500004 CCTGCGTGGGAGGGAGAGGCAGG - Intronic
1090636320 11:128692573-128692595 CTAGAGAGGGAGGGGGAGGGAGG + Intronic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1090963743 11:131580414-131580436 CCTCAGAGGGCAGGTGTGGCAGG - Intronic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1202820966 11_KI270721v1_random:69107-69129 GCTGATGGGGATGGGGTGGCCGG + Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091538428 12:1435910-1435932 CCTGAGAGGGTACAGGTGGCAGG - Intronic
1091705213 12:2688897-2688919 CCTGAGAGGGAGGGTCTTTCGGG - Intronic
1092124101 12:6063856-6063878 GCTGAGAGATCGGGGGTGGCTGG - Intronic
1092161367 12:6317161-6317183 CCTGGGAGGGAGGGACTGTCAGG + Intronic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092887138 12:12934775-12934797 GCAGAGAGGGAGGGGCTGGAGGG + Intergenic
1093125502 12:15322981-15323003 CTTGAGAGGTAGGGGGCGGGGGG + Intronic
1093516329 12:19990808-19990830 CTTAAGAGGGAGAGGGAGGCAGG + Intergenic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1095193931 12:39290356-39290378 CCTGAGTGGTCGGGGCTGGCTGG - Intergenic
1095672405 12:44876354-44876376 CCGGGGAGGGAGGGGCGGGCCGG + Intronic
1095905066 12:47369154-47369176 CCTGAGAAGGTGAGGGGGGCTGG + Intergenic
1095942224 12:47734875-47734897 CCTGAGAGAGAGGGGACAGCTGG + Intronic
1095970393 12:47897742-47897764 CCTGAGAAGCAAGGGGTAGCTGG - Intronic
1096021696 12:48330307-48330329 CCTGGAAGGGAAGGGGTGGGTGG + Intergenic
1096078635 12:48819503-48819525 GCAGAGATGGAGGGGGTGGAAGG - Intronic
1096497109 12:52044969-52044991 CCTGAGAGGGAGGGAGGGAGGGG + Intronic
1096525319 12:52206909-52206931 ACAGAGAGGGAGGTGGGGGCCGG + Intergenic
1096683819 12:53274703-53274725 CATGAGGGGGCGGGGTTGGCAGG - Intronic
1096815174 12:54197393-54197415 CCTGAGACAGAGGGAGTGACTGG - Intergenic
1096818420 12:54216141-54216163 CCTGAGTGGGGGTGTGTGGCGGG + Intergenic
1096863943 12:54550029-54550051 CCTGAGCGGGAGGAGGAGGGGGG + Intronic
1097232878 12:57522940-57522962 GGTGAGTGGGAGGGGGTGGGAGG - Exonic
1097439837 12:59596074-59596096 GCGGAGAAGGAGGCGGTGGCGGG - Intronic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1099246275 12:80196880-80196902 CATGAGGGGAAGGGGGTGGTCGG + Intergenic
1100178676 12:92059822-92059844 AATGAGAGGGAGGGGGTCCCAGG + Intronic
1100270185 12:93017120-93017142 CCCGAGAGAGAGAGGCTGGCTGG + Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100716588 12:97312661-97312683 CATTAGTGGGAGGAGGTGGCTGG + Intergenic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1101569295 12:105938191-105938213 CCTGAGTTGGAGGTGGTGGGTGG - Intergenic
1101606053 12:106248154-106248176 CCGGAGAGGGAGGGCCGGGCGGG + Intronic
1102015743 12:109646797-109646819 CCAGACAGGGTGGTGGTGGCTGG - Intergenic
1102031383 12:109741898-109741920 CCTGCCAGGCAGGGAGTGGCTGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102720620 12:115013216-115013238 ACAGAGAGGGAGGTGGTGACAGG - Intergenic
1102785970 12:115605141-115605163 ACTGAGAGGGAGTGAGTGACAGG + Intergenic
1102906090 12:116676178-116676200 CCTGGGAGGGATGGGGTTGCAGG + Intergenic
1103188532 12:118981408-118981430 CCTGAGGAGGAGGGGGTTGGTGG + Intergenic
1103327695 12:120132380-120132402 CCTGTGAGGCAGGGAGGGGCGGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103557462 12:121775164-121775186 CCCGGGAGGGCTGGGGTGGCAGG + Intronic
1103729821 12:123020030-123020052 CCTGCGAGGCAGGAAGTGGCAGG + Intronic
1103825108 12:123731819-123731841 GGTGGGAGGGAGGGGATGGCAGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1103932244 12:124457056-124457078 CAGGGGAGGGCGGGGGTGGCTGG - Intronic
1103967777 12:124651160-124651182 GCTGAGAGGAAGGAGCTGGCTGG + Intergenic
1104248113 12:127062250-127062272 CCAGAGATGGAGGGAGAGGCAGG - Intergenic
1104753109 12:131252303-131252325 CCTGAGAGTGAGGGTGATGCTGG - Intergenic
1104901358 12:132191025-132191047 CCAGCGAGGGAGGAGGTGGGAGG + Intergenic
1106413334 13:29525944-29525966 CCAGGGTGGGAGTGGGTGGCCGG - Intronic
1107408135 13:40134297-40134319 CCTGAGAGAGAGGAGGGAGCAGG - Intergenic
1107432870 13:40355565-40355587 CCTGAGAGAGTGTGGGTGACTGG - Intergenic
1107718323 13:43222302-43222324 GCTGGCGGGGAGGGGGTGGCGGG - Intronic
1108506252 13:51115371-51115393 CCTGAAAGGGACAGGGTGCCTGG - Intergenic
1109094561 13:58096524-58096546 CCTGAGAGGGACCCGGTGGGAGG + Intergenic
1109308052 13:60662169-60662191 GCTGGGGGGGTGGGGGTGGCAGG - Intergenic
1109478738 13:62919626-62919648 CCGGAGAGGGATGAGGTGGCAGG + Intergenic
1110318571 13:74135476-74135498 CGGGAGAGGGAGGAGGCGGCCGG + Intergenic
1110727642 13:78843752-78843774 CGTGGGTGGCAGGGGGTGGCGGG - Intergenic
1111074819 13:83220333-83220355 CCTGAAAGGAAGGGAGTGGTAGG - Intergenic
1111078857 13:83276555-83276577 CCTGAGAGGGACGGGGTAGGAGG - Intergenic
1111529516 13:89518483-89518505 CATGACAGGGAAGGGGTGGGGGG + Intergenic
1111738225 13:92169172-92169194 CCTGTCAGGGGTGGGGTGGCGGG + Intronic
1111770129 13:92585723-92585745 TGTGAGAGGGATGTGGTGGCAGG + Intronic
1113494191 13:110714564-110714586 GCTGCGGGGGAGGGGGCGGCGGG + Intronic
1113598727 13:111553200-111553222 TGTGAGAGGGAGGGAGTGGATGG + Intergenic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1115761743 14:36582902-36582924 CCGGGAAGGGTGGGGGTGGCAGG + Intergenic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1117115252 14:52504102-52504124 CCTGAAAGTGAGGGGGAGGATGG + Intronic
1117800848 14:59443260-59443282 TCTGAGAGTGAGGAGGAGGCAGG - Intronic
1117973056 14:61271200-61271222 CCTGGGAGAGAGGGGGTGAATGG - Intronic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118366760 14:65102724-65102746 CCGGGGAGGGGGGGGGGGGCGGG + Intergenic
1118836836 14:69484125-69484147 CCTGAGGGGGAAGGGTTGGGGGG + Intergenic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1119380677 14:74226250-74226272 CCTGGTAGGGTGGGGGTGGAGGG - Intergenic
1119656638 14:76421837-76421859 CCAGGGAGGGAGGGTGTGGTTGG + Intronic
1119792995 14:77369911-77369933 CCTGTAAGGGAGGCGGAGGCGGG + Intronic
1120301644 14:82714942-82714964 CAGGAAAGGGAGGGGATGGCAGG - Intergenic
1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG + Intronic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1120713834 14:87819329-87819351 GCTGAGAGTGAGGGGGCAGCAGG + Intergenic
1121010563 14:90517770-90517792 CCTTTGAGAGAGCGGGTGGCAGG - Intergenic
1121122588 14:91385347-91385369 CCTGATGGGGTGGGGGTGGTGGG - Intronic
1121210810 14:92206969-92206991 AATGAGAGGGAGGGTGTGGGTGG + Intergenic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1121494732 14:94384360-94384382 CTTTTGAGGGAGGGGTTGGCAGG + Intronic
1122064199 14:99160201-99160223 CCGGAGAGTGAGGGGCAGGCTGG + Intergenic
1122180736 14:99952789-99952811 CCTGGAAGGGAAGGGGTGGGGGG - Intergenic
1122605572 14:102945431-102945453 ACTGAGCGGGAGTGGGTGGGGGG - Intronic
1122768211 14:104085646-104085668 CCTGGGAGGGCGGGGCCGGCGGG - Intergenic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1122896299 14:104759049-104759071 TCTGAGAGGAAGGTGCTGGCAGG + Intronic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1123892438 15:24794775-24794797 GCAGAGAGGGTGGGGGTGGGTGG + Intergenic
1124877836 15:33612109-33612131 CCTGAGAGGGGAGGGGTAGGTGG + Intronic
1124955718 15:34359095-34359117 CCTGAGGAGGAGGGGGTGAGAGG + Exonic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1125797036 15:42410669-42410691 GCTGAGAAGGAAGGGGTGGCAGG + Intronic
1126143021 15:45452923-45452945 CCCGTGGGGGAGGGGGGGGCGGG + Intergenic
1126143542 15:45456346-45456368 GCTGAGTGGGAGGGGCTGCCTGG - Intergenic
1126257967 15:46650454-46650476 CCTTAGAGAGAGAGGGTTGCTGG - Intergenic
1126297437 15:47156188-47156210 CCTGAGAGTGAGGTGGGTGCAGG - Intergenic
1126697908 15:51341452-51341474 CCTGCGGAGGAGGGGCTGGCAGG - Intergenic
1127638753 15:60895544-60895566 TCTGAGAGGGGGGTGGAGGCAGG - Intronic
1128149822 15:65355849-65355871 GCTCTGGGGGAGGGGGTGGCGGG - Intronic
1128161530 15:65425924-65425946 CCTAAGTGGCATGGGGTGGCAGG + Intergenic
1128451349 15:67807499-67807521 CCTGAGAGGTGAGAGGTGGCAGG - Intergenic
1128510579 15:68311612-68311634 CCTGAGAGGGGATGGGTGGCTGG + Intronic
1129306427 15:74667449-74667471 GGGGAGAGGGAGGGGGTGGAGGG + Intronic
1129324727 15:74794092-74794114 GCTGTGGGGGTGGGGGTGGCGGG - Intronic
1129324765 15:74794202-74794224 GCTGTGAGGGTGGGGGTGGCGGG - Intronic
1129324784 15:74794257-74794279 GCTGTGGGGGTGGGGGTGGCGGG - Intronic
1129324805 15:74794312-74794334 GCTGTGGGGGTGGGGGTGGCGGG - Intronic
1129324826 15:74794367-74794389 GCTGTGAGGGTGGGGGTGGCGGG - Intronic
1129325982 15:74800535-74800557 CCTGCGTGGGAGGAGGTGGGTGG - Intronic
1129326292 15:74801878-74801900 CCTGAGAGAGAAGGTGGGGCTGG + Exonic
1129425948 15:75462991-75463013 GCTGAGAGGTAGGTAGTGGCTGG - Intergenic
1130847304 15:87759241-87759263 CCTGAATGGGAGGGGATGGCAGG + Intergenic
1131180247 15:90234158-90234180 CCGGGGTGGGAGGGGGGGGCGGG + Intronic
1131366732 15:91847810-91847832 CCTGAGGGGTAGTGGGTGCCAGG - Intergenic
1131604353 15:93885366-93885388 CCTGAGATGGCGGGGCTGACTGG + Intergenic
1132071137 15:98777407-98777429 TCTGAGAGGGAGGTGGTGAGGGG + Intronic
1132223466 15:100122997-100123019 CTTGTGGGGGAGGGTGTGGCTGG + Intronic
1132242980 15:100275293-100275315 CATGAAAGGCAGGGGGTGGGGGG + Intronic
1132292712 15:100714464-100714486 CCTGGTAGGAAGGAGGTGGCAGG + Intergenic
1132588912 16:717905-717927 CCTGTGAGGGAAGGGGCTGCAGG + Exonic
1132664723 16:1076199-1076221 GGGGAGAGGGAGGGGGAGGCGGG - Intergenic
1132664741 16:1076247-1076269 AGGGAGAGGGAGGGGGTGGCAGG - Intergenic
1132688752 16:1172979-1173001 CCTGGGAGGGAGGGGAGGGGTGG + Intronic
1132796902 16:1729046-1729068 CCACAGAGGGAGGGGGTTCCAGG - Intronic
1132847294 16:2006467-2006489 CCTGAGGGTGAGGAGGGGGCTGG + Intronic
1132974178 16:2703298-2703320 CCTCAGAGCCAGGTGGTGGCTGG + Intronic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133171659 16:3985819-3985841 CCAGAGGGGGAGGCTGTGGCAGG - Intronic
1133200997 16:4204436-4204458 CCTGAGAGCCAGGGCGTGCCGGG - Intronic
1133214553 16:4283682-4283704 ACAGAGAGGGAGGCAGTGGCGGG - Intergenic
1133231621 16:4369707-4369729 CCTGAGCGGGAGGGATGGGCTGG - Intronic
1133296894 16:4758311-4758333 CCTGAGAGGGAAGCTGTGTCTGG + Intronic
1133747983 16:8701920-8701942 GCAGAGCAGGAGGGGGTGGCAGG + Intronic
1134291901 16:12908300-12908322 TCTGAGTGGGAGGGGCTGGCAGG + Intronic
1134659738 16:15975083-15975105 CTTAAGAGTGAGGGGGAGGCTGG - Intronic
1134880903 16:17744979-17745001 GCTGGGAGGGAGGGGCTGGGTGG + Intergenic
1135191290 16:20356779-20356801 CCTGAGATGGAGAGGTTGTCTGG + Intergenic
1135227589 16:20674913-20674935 CCAGAGTGGCTGGGGGTGGCAGG + Intronic
1135609656 16:23855144-23855166 CCGGCGGGGGAGGGGGTGGCAGG + Intronic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1136234064 16:28903781-28903803 GCTGAGGGGGCGCGGGTGGCAGG - Intronic
1136244926 16:28969500-28969522 CCTGAGTTGGAGGGGGTGACAGG - Intergenic
1136381561 16:29898448-29898470 CCAGAGAGAGAGAGGGTGGGGGG - Intronic
1137056245 16:35747931-35747953 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1137057779 16:35753728-35753750 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1137686504 16:50390553-50390575 CCTGAGCAGGAGGGGATGGCAGG - Intergenic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138594539 16:58022783-58022805 GCTGAGGGGGAGGGGTGGGCAGG + Intergenic
1138654849 16:58485351-58485373 CCTGTGACGGAGGTGGTGGCGGG - Intronic
1139390754 16:66605246-66605268 CCAGAGAGGGCGGGGGCGCCTGG - Intronic
1139607765 16:68032175-68032197 CCTTAGAGGCAGGGTGTGTCAGG + Intronic
1139937717 16:70583500-70583522 CCTGAGATGCAGGGGAAGGCTGG - Intronic
1139953863 16:70684364-70684386 CATGAGGGGCAGGGGGTGGGGGG + Intronic
1139960132 16:70712706-70712728 CTTCTGAGGGAGGAGGTGGCAGG + Intronic
1140280021 16:73545344-73545366 TTTTAGAGGGAGGGGGTGGCAGG + Intergenic
1140334731 16:74094740-74094762 CCTGAGTGGGAGGGCAGGGCAGG - Intergenic
1140981453 16:80113488-80113510 TCTCAGAGGTATGGGGTGGCGGG + Intergenic
1141152350 16:81572880-81572902 TCTGAGACGGAGGGGGTTCCTGG - Intronic
1141172078 16:81697849-81697871 CCTGAGAGGCCTGGGGTGGCCGG - Intronic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141671835 16:85496232-85496254 CCTTGGAGGCACGGGGTGGCGGG - Intergenic
1141683070 16:85555334-85555356 ACTCAGAGAGAGGGGGTGGAAGG - Intergenic
1141764022 16:86046918-86046940 CCCGACAGGAATGGGGTGGCAGG + Intergenic
1141876047 16:86825255-86825277 CCTGAGAGTGAGGGAGGGGCGGG - Intergenic
1141955698 16:87370152-87370174 CCTGAGAGGGAGGGGAGAGTGGG - Intronic
1142117706 16:88368619-88368641 CCTGAGAGGGTGTGGCTGGGAGG + Intergenic
1142129171 16:88424957-88424979 CCTGAGAGGGAGAGGAAGGCCGG - Intergenic
1142209544 16:88802310-88802332 CCTGCGAGGGAAGGGGACGCGGG - Intergenic
1142363414 16:89637759-89637781 CGTCAGAGGGATGAGGTGGCTGG + Intronic
1142434567 16:90047986-90048008 GGTGAGAGGGAGCGGGGGGCGGG + Intergenic
1142594410 17:1022554-1022576 GCAGAGAGGGAGGGGCTGCCAGG + Intronic
1142619245 17:1154474-1154496 GCTGGGAGGAAGGGGCTGGCCGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142709517 17:1715704-1715726 CCTGGCAGGGAAGGGGTCGCTGG - Intergenic
1142958099 17:3534989-3535011 CCAGAGAAGGAGGGGCTGGGAGG - Intronic
1143109134 17:4543782-4543804 CCCAGGAGGGAGGCGGTGGCAGG - Intronic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143492780 17:7294027-7294049 CCTGGGAGAGAGGGCGGGGCCGG - Intronic
1143590385 17:7882822-7882844 CCTGAGAGGGAGGGGTAGGTGGG - Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1144269454 17:13602106-13602128 CTGGAGAGGGCGGGGGCGGCAGG + Intergenic
1144770990 17:17759471-17759493 CATCAGAGGGTGGGGGTGGTGGG - Intronic
1144782233 17:17814017-17814039 CCTGGGAGGAGGGGGGTGGATGG - Intronic
1144840206 17:18181398-18181420 TGTGAGGGGGAGGGGGTGTCAGG + Intergenic
1145264440 17:21372920-21372942 GCTGAGAGGGGGAGGGTGTCTGG + Intergenic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145904576 17:28509190-28509212 ACAGAGAGGGAGGGAGGGGCAGG - Intronic
1146127119 17:30238467-30238489 GCTCAGAGGGAGGGAGTGGGAGG - Intergenic
1146547536 17:33751862-33751884 GCTGAGAGGCAGCGGGAGGCTGG + Intronic
1146918366 17:36692626-36692648 TCAGAGAGGGAGGGAGTGGGGGG - Intergenic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147141630 17:38463683-38463705 CCAGACAGGGAGGGGGTGCAGGG - Intronic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147384724 17:40074384-40074406 CCTGGGTGGCAGGGGGTGGGTGG + Exonic
1147430319 17:40366865-40366887 CCTGAGCTGGAGGGAGTGGTGGG - Intergenic
1147557000 17:41486005-41486027 TCTGAGTGGGAGGCGGTGGCAGG - Intergenic
1147900205 17:43778758-43778780 CCCGAGAGGGACGGCGGGGCCGG + Intronic
1147995777 17:44359725-44359747 ACTCAGATGGAGGGGGTGCCTGG - Intronic
1148093875 17:45039230-45039252 CCTGACAGGGAGCTGCTGGCAGG - Intronic
1148124687 17:45230705-45230727 AGTGGGAGGGAAGGGGTGGCTGG - Intronic
1148158611 17:45437326-45437348 GCTTAGAGGTAGCGGGTGGCTGG - Exonic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148240775 17:45998232-45998254 CCTGGGTGGGGGGAGGTGGCAGG - Intronic
1148243074 17:46012750-46012772 CGTGAGAGGGGGAGGGGGGCTGG - Intronic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148438962 17:47701989-47702011 CCTGAAAGGAAGCGTGTGGCTGG - Intronic
1148550926 17:48550515-48550537 CCATAGAGGGAGGGGCCGGCAGG + Exonic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148636760 17:49154725-49154747 CCTGAGACAGAGGGGGATGCAGG + Intronic
1148645878 17:49219518-49219540 CCTGCGAGGGAGCGGGAGGTAGG - Exonic
1148789721 17:50166404-50166426 CCTGGGAGGGAGGGTGGAGCTGG + Intronic
1148790187 17:50168445-50168467 GCTGAGAGGAAGCGGCTGGCAGG - Exonic
1149304707 17:55336271-55336293 CCTGGGGAGCAGGGGGTGGCTGG - Intergenic
1149414505 17:56445234-56445256 CCTGAAAGTGAGGAGGTGTCTGG + Intronic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1150055269 17:62008681-62008703 CCTCGGGGGGAGGGGGCGGCGGG - Intronic
1150182405 17:63138152-63138174 CCAGAGACGCAGGGGGTGGGAGG - Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150424830 17:65068994-65069016 GCTGGGAGGGAGGGGGAGGAAGG - Intergenic
1150488326 17:65559272-65559294 GCGCAGAGGGAGGGGGTGGGTGG - Intronic
1150624804 17:66835057-66835079 CCCGAGAGGGAGGGGCGGGCAGG - Intergenic
1150830759 17:68517616-68517638 CCTGAGAGGGACCTGGTGGGAGG - Intronic
1151425083 17:74025799-74025821 GGTGGGAGGGATGGGGTGGCTGG - Intergenic
1151554658 17:74840647-74840669 CCTGGGAGGAAGGCTGTGGCAGG - Intergenic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1151844267 17:76640266-76640288 CCTGGGAGGGAGGGGCAGGGTGG + Intronic
1152029342 17:77832003-77832025 CCTGAGAACGAGGCGGGGGCAGG - Intergenic
1152237058 17:79144165-79144187 GCTCAGAGGCAGGGGGAGGCAGG - Intronic
1152241916 17:79165419-79165441 CCTGGGAAGGAGGGGGTGCCTGG + Intronic
1152307051 17:79527221-79527243 CCTGGCAGGGAAGAGGTGGCAGG - Intergenic
1152381084 17:79942515-79942537 CATGACAGGGTGGGGGTGGGGGG + Intronic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152608486 17:81304538-81304560 CGTGAGAGTGTGCGGGTGGCTGG - Intergenic
1152897030 17:82917885-82917907 CCTGAGAGGGACAGAGCGGCGGG - Intronic
1153636383 18:7117261-7117283 GCTGCGCGGGCGGGGGTGGCGGG - Intronic
1153805740 18:8706777-8706799 CCCGGGAAGGAGGGGTTGGCGGG - Intronic
1154064105 18:11090512-11090534 CCTGAAAGGGTAGGGGTGGTCGG + Intronic
1154385142 18:13886486-13886508 TCTGACTGGGAGGCGGTGGCTGG + Intronic
1155442504 18:25876853-25876875 ACTGAGCGGGCGGGGATGGCAGG + Intergenic
1155910325 18:31498131-31498153 GCGGGGAGGGAGAGGGTGGCCGG + Exonic
1157482291 18:48063163-48063185 CCTGAGACAGAGGGGGTTTCTGG - Intronic
1157525372 18:48376559-48376581 CCTGAGAGAGGAGGGGTGGGAGG - Intronic
1158954044 18:62523256-62523278 CCGGCGAGGGGGGCGGTGGCCGG - Exonic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160340032 18:78081904-78081926 CCTGTGAGGCAGTGGGAGGCGGG + Intergenic
1160754123 19:748766-748788 CGTGAGAGAGTGGGGCTGGCGGG - Intergenic
1160800292 19:964498-964520 CAGAAGAGGGAGGGGGTGGTGGG + Intronic
1160869421 19:1270229-1270251 CCTGAGACTGGGGGGGGGGCTGG - Intronic
1160875507 19:1294661-1294683 GCTGAGAGAGAGGGGGCGGTGGG + Intronic
1160898051 19:1412055-1412077 CCTGGGAGGGCGGGGCTGGCAGG + Intronic
1160968762 19:1758129-1758151 ACGGAGAGGGAGGGGGAGACGGG + Intronic
1160979934 19:1812191-1812213 CAGGAGAGGCAGGGGGGGGCAGG + Exonic
1160980790 19:1815743-1815765 CCCGGGAGGGAGGGCCTGGCAGG + Exonic
1161128527 19:2574128-2574150 CGGGAGATGGTGGGGGTGGCTGG - Intronic
1161265394 19:3361233-3361255 CCCGAGAGGGGCGGGGCGGCAGG + Intronic
1161511581 19:4675169-4675191 CCTGAGTGGGAGGGGCTTCCGGG - Intergenic
1161682451 19:5687013-5687035 CCTGAGATAGAGGGGCGGGCCGG - Intronic
1161701928 19:5800486-5800508 CCTGTGGGGGTGGAGGTGGCTGG - Intergenic
1161812473 19:6478705-6478727 TCTGAGAGGGAGGGGTTGGGAGG + Intronic
1161812767 19:6479952-6479974 CCTGGGAGTGAGGGAGTGGGAGG - Intronic
1162024124 19:7884214-7884236 CTTGGGAGGGAGGGTGAGGCAGG + Intergenic
1162602380 19:11678705-11678727 CCTGAATGGTAGGGAGTGGCAGG - Intergenic
1162894793 19:13758846-13758868 CCTGGGAGGGAGCGGTGGGCAGG - Exonic
1162950158 19:14066688-14066710 TTTGAGAGGGAGGAGGTGGCTGG + Intergenic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163084991 19:14973020-14973042 TCTCAGAAGGCGGGGGTGGCTGG + Intronic
1163127735 19:15253397-15253419 CCTCAGTGGGAGGTGGAGGCAGG - Intronic
1163159164 19:15454600-15454622 GCTGGGAGTGTGGGGGTGGCAGG - Intronic
1163234139 19:16021234-16021256 TCTGAGAGGCTGGGGGTGCCAGG - Intergenic
1163843929 19:19628213-19628235 GCTGAGAGGGCGCGGGAGGCGGG + Intronic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164226439 19:23250195-23250217 CCGGAGAGAGAGGGAGGGGCTGG - Intronic
1164459913 19:28437805-28437827 CCTGGGTGGGAGGGGTTGGGCGG + Intergenic
1164572613 19:29385266-29385288 CAAGGGAGAGAGGGGGTGGCAGG + Intergenic
1164633018 19:29774051-29774073 CCTGTGGGGCAGGGGCTGGCTGG - Intergenic
1164667927 19:30053685-30053707 GCTGAGAGGGAGGAGGTGGTGGG + Intergenic
1164708330 19:30336650-30336672 CCAGAGAGGGAAGGTGTGTCTGG + Intronic
1164834553 19:31349274-31349296 ACAGGGAGGGAGGGGGCGGCGGG + Exonic
1165024514 19:32949832-32949854 GCTGACAAGGAGGTGGTGGCAGG + Intronic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166098476 19:40556229-40556251 GCCGAGAAGGAGGTGGTGGCTGG + Exonic
1166254459 19:41592396-41592418 CCTGGGAAGGAGGGGGTGTGGGG - Intronic
1167159346 19:47756917-47756939 ACTGAAAGGCAGGGGGTGTCAGG + Intronic
1167264757 19:48478047-48478069 CCTGAAAGGGAAGGGGTGGGAGG - Exonic
1167739673 19:51316939-51316961 CCTGGGAGGTAGGGGGTGGAGGG - Intronic
1167768986 19:51502009-51502031 ACTGAGAGGGAGGCAGTGGGCGG - Intergenic
1167789143 19:51661046-51661068 CTTGAGAGGGGTGGGGGGGCGGG - Intergenic
1168185714 19:54698203-54698225 ACTGAGAGGGAGGGTCTGCCAGG - Intronic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
1168281039 19:55305441-55305463 CCTGAGTGGGAGGGGGTGGTTGG - Exonic
1168297787 19:55386004-55386026 ACTGAGAGGGAGTGCGCGGCGGG - Intronic
1168301760 19:55408732-55408754 CCAGAGAAGGCGGGTGTGGCTGG - Intergenic
1168314177 19:55476816-55476838 CCGGAGGGGGTGGGGGTGGGGGG + Intronic
1168711710 19:58504571-58504593 CCTGGGGGGGGGGGGGGGGCGGG + Intronic
925025921 2:607241-607263 CCTGAGCGTGAGGGGTTGGTCGG + Intergenic
926309007 2:11661007-11661029 CAGGAGAGGGAAGGGGTGGGAGG - Intronic
926394658 2:12428507-12428529 TCTGTGAGGGCGGGGGTGCCTGG - Intergenic
926638093 2:15205774-15205796 CAGGAGAGAGAGGGGGTGGAAGG - Intronic
927472173 2:23385091-23385113 CCCGAGTGGGCGGGGGTGGCGGG - Intergenic
927490999 2:23520994-23521016 CCTGAGGGGGAGCGGGGGGGGGG - Intronic
927642646 2:24855192-24855214 CCTAAGAAGAAGGGGGTGGGGGG - Intronic
927705722 2:25295255-25295277 CATGATAGGGAGGCGGGGGCTGG - Intronic
927851410 2:26502252-26502274 CCTGACAGGGTGGGGGCAGCTGG + Intronic
928107171 2:28478019-28478041 CCTGTGTGAGAGGGAGTGGCTGG - Intronic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
929828236 2:45327245-45327267 CCAGTGTTGGAGGGGGTGGCTGG + Intergenic
929948727 2:46389833-46389855 GCTGGGAAGGAGGGGGCGGCCGG + Intergenic
930722291 2:54649131-54649153 GCTGAGAGGGAGGTGGTCGCAGG + Exonic
931041566 2:58306036-58306058 CATGGGAGGGAGGGGTTGGAAGG + Intergenic
931432024 2:62215861-62215883 CCTGAGTGGGTGGGGGTGACTGG + Intronic
931753034 2:65347460-65347482 TCTGAGAGTGAGGGGGTAGGAGG - Intronic
932182643 2:69662432-69662454 CCTGAGTGGGGAGGGGTGGGAGG + Intronic
932190546 2:69738511-69738533 CCTGAGTGGGGAGGGGTGGGAGG - Intronic
934490901 2:94761530-94761552 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
934650763 2:96090118-96090140 CCTGAGAGAGGGGCTGTGGCAGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
936165348 2:110115634-110115656 GCAGAGAGGGAGGGGGAGACCGG - Intronic
937098725 2:119252377-119252399 TCAGAGGAGGAGGGGGTGGCAGG - Intronic
937145989 2:119644997-119645019 CTTGGGTGGGAGGGGGTGGGGGG - Intronic
937245215 2:120488123-120488145 CCTCAGAGGGAGGGTGGGCCTGG - Intergenic
937264464 2:120607225-120607247 CAAGAGATGGAGGGCGTGGCAGG + Intergenic
937283688 2:120736836-120736858 GCAGAGGGGGAGGGGGCGGCCGG - Intronic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
937986551 2:127640626-127640648 CAAGGGAGGGAGGGGGTTGCTGG + Intronic
938278820 2:130050675-130050697 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
938502186 2:131835983-131836005 CCTGTGAGGGCGTGGGGGGCTGG + Intergenic
938652214 2:133395228-133395250 CCTGAGAGAGATGGATTGGCAGG + Intronic
939229940 2:139411458-139411480 CCTCAGATGGCGGGGGTGGGAGG - Intergenic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
940891831 2:159042725-159042747 CCAGAGAGAGAGGGGGTTTCAGG + Intronic
941293900 2:163711926-163711948 CCAGAGAGCGAGGGAGGGGCAGG - Intronic
941462961 2:165793655-165793677 CCTGAGAGGGAGGGCCCGGCGGG - Intronic
941677057 2:168355185-168355207 TGTGGGAGGGAGGGGGTGCCTGG - Intergenic
944075604 2:195727188-195727210 ATTTGGAGGGAGGGGGTGGCGGG + Intronic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
945167967 2:206966506-206966528 AATGAGAGGGAGGGGTGGGCAGG - Intronic
945902918 2:215558755-215558777 TCTGGAAGGGAGGGGGTTGCTGG - Intergenic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
946038358 2:216762767-216762789 CCTGTGAGGGTCGGGGTGGTTGG + Intergenic
946162324 2:217842899-217842921 AGTGAGAGGTAGGGGGTGGCTGG - Intronic
946191453 2:218010040-218010062 TCTGGGAGGGAGGGGGCGGGGGG + Intergenic
946225213 2:218260897-218260919 ACTGGGTGGGAGGGGGAGGCAGG + Intronic
947373974 2:229476347-229476369 GCTGAGAGGCAGGGGGAGGGCGG - Intronic
947834232 2:233163831-233163853 CCTGAGTGAGAAGGAGTGGCTGG + Exonic
947870675 2:233436170-233436192 CCAGTGAGGGAAGGGATGGCAGG - Intronic
948260944 2:236604061-236604083 CCTGACTGGGTGGGAGTGGCAGG - Intergenic
948761194 2:240192223-240192245 CCAGAGCGGGAGGTGGTGGGGGG - Intergenic
948867197 2:240782223-240782245 CCTGAGAGGAAGCGGGTGACAGG - Intronic
948947604 2:241229012-241229034 CCTGAGAGGCAGAGGGTGACGGG - Exonic
948993254 2:241565034-241565056 GCTGAGGGGAAGGGGATGGCTGG + Intronic
949051901 2:241902227-241902249 TCTGATGGGGTGGGGGTGGCGGG - Intronic
1169067467 20:2702044-2702066 CCTGAGGGCAAGGGGGTGGAGGG + Intronic
1169119383 20:3085805-3085827 CTTGAGAGGCAGGGGGTACCGGG - Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1170431239 20:16278803-16278825 ACTGAGAAGCAGGGGATGGCGGG - Intronic
1170452201 20:16495212-16495234 GCTGGGAGTGAGGAGGTGGCAGG - Intronic
1170732555 20:18987333-18987355 ACTGAGAGGGAGTGGGTCTCGGG + Intergenic
1171017253 20:21553184-21553206 CCTGAGAGGGATGGAGGGGGAGG - Intergenic
1171370067 20:24656736-24656758 CCTGAGAGGGAGGGGGCTGCGGG - Intronic
1172422038 20:34825665-34825687 CCGGGGAGGGAGGGGGAGGGAGG + Intergenic
1172468513 20:35174651-35174673 CCGGCGTGGGAGGGGGCGGCGGG - Intronic
1172654499 20:36528580-36528602 CCTGTGAGGTAGGGAGGGGCAGG - Exonic
1172871906 20:38141385-38141407 CCTGAGGGGGATAGGGGGGCGGG + Exonic
1172999744 20:39097145-39097167 GCAGGGAGGGAGGGGGAGGCAGG + Intergenic
1173188048 20:40856448-40856470 CTTGAGAGGGATGGGCTGGTGGG + Intergenic
1173733780 20:45345763-45345785 CCTGAGAGGGAGTGGCAGGAAGG + Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1173850709 20:46216173-46216195 CCTGGGACAGAGGGGTTGGCTGG + Intronic
1173868833 20:46329497-46329519 CCTTGGAGGGAAGGGCTGGCTGG + Intergenic
1174107442 20:48172570-48172592 CCAGAGAGGGAGGGAGGAGCTGG + Intergenic
1174311604 20:49660035-49660057 CCTGAGTGGGAGAGGGTGTCTGG - Intronic
1174583540 20:51590332-51590354 ATTGAGGGGGAGGAGGTGGCTGG - Intergenic
1174598754 20:51707050-51707072 CCTGTGACGGCTGGGGTGGCAGG - Intronic
1174761573 20:53211883-53211905 CCAAAGAGGGAGAGGGTGGGAGG - Intronic
1175065205 20:56278368-56278390 CTTGAGAGGCATGTGGTGGCTGG - Intergenic
1175121773 20:56721404-56721426 CCTGTGAGGGAGGGGCAGGGAGG + Intergenic
1175349770 20:58309661-58309683 GCTGAGAGGGCGGGGCCGGCCGG - Intergenic
1175402480 20:58708392-58708414 CCTGGGCAGGAGGGGCTGGCAGG + Intronic
1175408253 20:58749251-58749273 CCTCAAAGGGTGTGGGTGGCTGG + Intergenic
1175573969 20:60046584-60046606 CCTGTGTGAGAGTGGGTGGCAGG + Intergenic
1176065836 20:63194144-63194166 ACAGAGTGGGAGGTGGTGGCAGG - Intergenic
1176130921 20:63496543-63496565 CCTCAGAGGGATGGGGAGGCTGG - Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176178293 20:63738713-63738735 CCTGAGCGGGAGGGTCTGGTAGG - Exonic
1176256289 20:64154829-64154851 CCAGAGAGGGAAGGGGCAGCTGG - Intronic
1176382655 21:6120915-6120937 CCTGGGTGGGTGAGGGTGGCGGG + Intronic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1177799104 21:25809860-25809882 AGAGAGAGGGAGGGGGTGCCAGG - Intergenic
1177996268 21:28103255-28103277 TCTGAGAGGAAGGAGGTGTCAGG + Intergenic
1178115201 21:29409885-29409907 AATGTGAGGGAGGGGGTAGCAGG - Intronic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178474944 21:32929776-32929798 GCTGAGATAGAGGAGGTGGCGGG + Intergenic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1178515768 21:33245957-33245979 CCAGAGAGGGAGGGGGTCTCAGG + Intronic
1178604371 21:34022935-34022957 CTTGAGAATGAGGGGATGGCAGG + Intergenic
1179017249 21:37604822-37604844 GCTGAGTGGGAGGGGTTGGATGG - Intergenic
1179403816 21:41108945-41108967 CCTGAGATGTGGGAGGTGGCAGG - Intergenic
1179469772 21:41602782-41602804 GGTGAGAGGGAGGGGGTGAGAGG + Intergenic
1179484889 21:41703941-41703963 CCTACGAGGGAGGGAGTGGGGGG + Intergenic
1179591993 21:42415019-42415041 CCTGACACCGAGGGGGTGGAGGG + Intronic
1179740814 21:43417324-43417346 CCTGGGTGGGTGAGGGTGGCGGG - Intronic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180064111 21:45404523-45404545 CCTGGGAGGGAGGAGGAGCCTGG + Intergenic
1180088260 21:45517816-45517838 CCTGAGGGAGGGTGGGTGGCTGG - Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180185234 21:46135931-46135953 GGTGACAGGGAGGGGGTGCCGGG - Intergenic
1180231501 21:46429318-46429340 CGTGAGAGGCATGGGGGGGCTGG + Intronic
1180713818 22:17858169-17858191 CCTTGGCGGGAGGGGGTGGTAGG - Intronic
1180831934 22:18910981-18911003 CTGGAGAAGGCGGGGGTGGCTGG + Exonic
1181004832 22:20008346-20008368 CCTGAGTGAGAAGGGCTGGCGGG - Intronic
1181007687 22:20021701-20021723 CGTCAGAGGTAGGGGCTGGCAGG + Intronic
1181067911 22:20315361-20315383 CTGGAGAAGGCGGGGGTGGCTGG - Exonic
1181081661 22:20419601-20419623 CCTGAGAGGGCGGTGGGGTCAGG - Intergenic
1181084019 22:20430977-20430999 CCAGGGAGGGAGGAGGTGGAAGG - Intronic
1181425320 22:22833686-22833708 TCTGAGAGGGAGGTGGGGGCAGG + Intronic
1181426803 22:22849055-22849077 AGGGAGAGGGAGGGGGTGGTAGG - Intronic
1182130001 22:27843832-27843854 GCAGAGATGGAGAGGGTGGCTGG + Intergenic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1182862173 22:33569702-33569724 GCTGTGGGGGTGGGGGTGGCTGG - Intronic
1182996367 22:34816618-34816640 AGTGAGAGGGAGGAGGTGACAGG + Intergenic
1183189774 22:36314382-36314404 CTTGAGAAGGAGGGTGGGGCAGG + Intronic
1183230471 22:36578832-36578854 CCTGTGCTGGAGGGGGTGGATGG + Intronic
1183665081 22:39242432-39242454 GCTGTTGGGGAGGGGGTGGCCGG - Intronic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1183952117 22:41357835-41357857 CCCCAGGGGGAGGGGGTGGGAGG - Exonic
1184036206 22:41919549-41919571 CGTGGGAGGGAGGGGGCGCCCGG + Intergenic
1184233174 22:43169282-43169304 CCTGAGAGGGAGGGAGCTGGAGG - Intronic
1184271660 22:43387894-43387916 CTTGTGAGGGAGGGGGTTGGAGG + Intergenic
1184305891 22:43601694-43601716 CCTCAAGGGGAAGGGGTGGCAGG + Intronic
1184410995 22:44326395-44326417 CAGCAGAGGGAGGGGATGGCCGG - Intergenic
1184420552 22:44380509-44380531 TCTGGGAGGGAGGGGGCCGCGGG + Intergenic
1184454393 22:44600938-44600960 CCCCAGAGAGAGGAGGTGGCCGG - Intergenic
1184606122 22:45575829-45575851 CCCTAGAGGGCGGGGGTGGTTGG - Intronic
1184882293 22:47316219-47316241 GAGGAGAGGGAGGGGGAGGCTGG - Intergenic
1185090003 22:48761090-48761112 ACTGGGAGGGCTGGGGTGGCTGG - Intronic
1185190470 22:49433130-49433152 CCAGACAGGGAGAGGGTGGATGG - Intronic
1185199178 22:49491481-49491503 CCTGTGTGGGATGGAGTGGCCGG - Intronic
1185417871 22:50720081-50720103 CCTCTGTGGGAGGGGGTTGCCGG + Intergenic
1203282012 22_KI270734v1_random:136252-136274 CTGGAGAAGGCGGGGGTGGCTGG + Intergenic
949797020 3:7862577-7862599 CCTTAGAGGGAGCGACTGGCTGG + Intergenic
949976891 3:9468843-9468865 CGTTTGGGGGAGGGGGTGGCTGG + Intronic
950097348 3:10337877-10337899 CCTGAGAGGGTGGGGAAGGGTGG - Intronic
950576055 3:13832746-13832768 CCTGACATGGAGGGGATGGCAGG + Intronic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
951068867 3:18301895-18301917 CATGAGAGGGAGCTGGTGGGAGG + Intronic
952508991 3:34035409-34035431 CCTGAGGGGCTGGGGCTGGCTGG + Intergenic
952962356 3:38600354-38600376 CCTGAGAGGGCTGAGGTGGCTGG + Intronic
953067996 3:39492306-39492328 GCAGTGAGGGAAGGGGTGGCTGG - Intronic
953419997 3:42747024-42747046 GCTGCGGGGGTGGGGGTGGCAGG + Intronic
953613505 3:44468669-44468691 CCTCGGGGGGAGGGGGTGGAGGG - Intronic
953899943 3:46834165-46834187 CCTGCGAGGGACGAGGGGGCAGG + Intergenic
953925932 3:46982432-46982454 CCCCAGGGGGAGGGGGTGGGTGG - Intronic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
953999414 3:47544044-47544066 CCTGAGTGGGAGGGAGTGTCGGG + Intergenic
954108237 3:48420454-48420476 GCTGAGAGGCAGGGGATGTCTGG - Intronic
954129006 3:48550279-48550301 GCTGAGAGGGAGGGGTGCGCTGG - Intronic
954224039 3:49171518-49171540 CCTGAGTCGGAGGGGGAGGGGGG + Intergenic
954402261 3:50325199-50325221 ACTGTAAGGGAGGGGGTGGTAGG + Exonic
954413262 3:50380524-50380546 CCTGAGTGGGTGGGGGTGCTGGG + Intronic
954458307 3:50611796-50611818 CCTGCGAGGGCGAGGGGGGCGGG + Intronic
954497917 3:50982871-50982893 ACTGAGTGGGAGGGAGTGGGTGG + Intronic
954574227 3:51666401-51666423 CCTGAGGGGGGCAGGGTGGCTGG + Exonic
954949120 3:54453462-54453484 CCTGAGAGGGATGGTGTTTCAGG - Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955585368 3:60471802-60471824 TGTGAGAGGGGTGGGGTGGCAGG - Intronic
956102689 3:65784940-65784962 CTTGAGAGGGTGGCGGTGGAGGG + Intronic
956934951 3:74089974-74089996 GAAGAGTGGGAGGGGGTGGCTGG - Intergenic
957016469 3:75069879-75069901 CCAGAGGAGCAGGGGGTGGCGGG - Intergenic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957559104 3:81798690-81798712 CCTGAAAGAAAAGGGGTGGCTGG - Intergenic
959671879 3:108987621-108987643 GCTGAGAGGGTGGGAGTGGATGG + Intronic
960939742 3:122925847-122925869 ACACAGAGGGAGGGGGTGGGAGG + Intronic
960969896 3:123131838-123131860 CGTGAGAGCCAGGGGATGGCAGG + Intronic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961481683 3:127184506-127184528 CCACAGGTGGAGGGGGTGGCAGG + Intergenic
961519206 3:127456983-127457005 ACCAAGAGGGAGGGGGTGGATGG + Intergenic
961537184 3:127577285-127577307 CCCGAGAGGGAGGGCCAGGCTGG - Intronic
961630828 3:128297158-128297180 CCTGAGAGGGAGGGGTGGTCAGG + Intronic
961650436 3:128414275-128414297 CTTGGGAGGGAGGGAGTGGGAGG - Intergenic
961663330 3:128481780-128481802 CCTGGGAGGGGCGGGGTGGCCGG + Intronic
961665458 3:128491205-128491227 GCTCAGAGGGGGGGGGGGGCTGG - Intronic
962151218 3:132895258-132895280 AGTGAGTGGGAGGGAGTGGCTGG + Intergenic
962755395 3:138462009-138462031 CCTGCTAGGGATGGAGTGGCAGG + Intronic
962803561 3:138910617-138910639 CCCAAGATGGAGTGGGTGGCGGG + Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966155444 3:176911225-176911247 CCTGAGAGAGAGAGGAGGGCTGG - Intergenic
967278075 3:187795882-187795904 CCTGGCAGAGAGGTGGTGGCCGG - Intergenic
967304850 3:188050347-188050369 CCTGAGCAGGACGTGGTGGCAGG - Intergenic
967993717 3:195151064-195151086 TAAGAGAGGGAGGGGGTGGGAGG - Intronic
968205990 3:196800959-196800981 GCTGAGAGGGAGGGGGTAGGGGG + Intronic
968433724 4:574840-574862 CCTGAGCGGGGCGGGGTGGGTGG + Intergenic
968504931 4:967283-967305 CCTGAGAGGAAGGGGGCAGCCGG + Exonic
968505496 4:969273-969295 CCAAGGAGGGAAGGGGTGGCAGG - Intronic
968551086 4:1223665-1223687 CCTGAGAGGGTGGGCGGGGGTGG - Intronic
968741409 4:2333325-2333347 CCTGGGAGGCAAGGGGAGGCGGG - Intronic
968758481 4:2428690-2428712 CCTGAGAAGGAGTGGCTGCCAGG - Intronic
968903551 4:3441965-3441987 CCTGAGGGGCAGTGGGAGGCGGG - Exonic
968943973 4:3654025-3654047 CCTGAGCGGGCGGAGGTGGAGGG + Intergenic
969052799 4:4385375-4385397 CCTGAGACGGGGGGCGGGGCGGG + Intronic
969220607 4:5756171-5756193 CCTGAGATGCAGGGGATGGTTGG + Intronic
969258847 4:6021295-6021317 CCTGAGAGCTGGGGGGAGGCTGG + Intergenic
969294735 4:6263162-6263184 CCTGTGAGGGAGCGGGTAGCAGG + Intergenic
969331364 4:6474937-6474959 ACAGAGAGGCTGGGGGTGGCAGG - Intronic
969442947 4:7227946-7227968 GCTGTGAGGCAGGGGGTGGCGGG + Intronic
969448697 4:7260375-7260397 CCTGGGAGGGGGGAGGTGGGAGG - Intronic
969513185 4:7631388-7631410 CCAGGCAGGGAGGGGGTGGGAGG + Intronic
969690344 4:8700828-8700850 CCCACCAGGGAGGGGGTGGCTGG - Intergenic
969719476 4:8885348-8885370 CCTGAGAAGGAGTGGGTGAGTGG + Intergenic
971248078 4:24948606-24948628 CCTGGGAGGGAGGGAGTTGTAGG - Intronic
971468867 4:26997495-26997517 CCTGAGTGGGTGAGGGTGTCAGG - Intronic
971858316 4:32071861-32071883 CCTGAGAGGGACTGGTAGGCAGG + Intergenic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
973619402 4:52712314-52712336 CCTGAGCGGGGCGGGGTGGAGGG - Intergenic
973666115 4:53161141-53161163 CCTTAGAGGGAGGGAGTAACCGG + Intronic
973885646 4:55318305-55318327 CCTGAGAGCAAGGTGCTGGCTGG + Intergenic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
975242049 4:72071607-72071629 GCTGAGAGGTAGGGGATGGATGG - Intronic
975661127 4:76689726-76689748 ACGGAGAGGGAGGCGGGGGCCGG + Intronic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
979474094 4:121134810-121134832 ACTGTGAGGAAGGGTGTGGCTGG - Intronic
979654350 4:123174937-123174959 CCTGAGGGGGATGAGGTGGGAGG - Intronic
981054792 4:140349745-140349767 CTGGTGAGGGAGGTGGTGGCAGG - Intronic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983353495 4:166625148-166625170 CTTAAGAGGGAGGGGAGGGCAGG + Intergenic
983549519 4:169001664-169001686 CAAGAGAGAGAGGAGGTGGCAGG - Intronic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
983824992 4:172248665-172248687 CCTGAGAGGGATCCGGTGGGAGG + Intronic
983890479 4:173024976-173024998 GCTGGGAGGGAGGGGTTGGCTGG - Intronic
984638692 4:182141316-182141338 CAAGAGAGGGCGGGGATGGCGGG - Intergenic
985069010 4:186150242-186150264 CCTTGGAGGGAGGGGGAGGGAGG - Intronic
985511013 5:313949-313971 TGTGAGAGGGAGGGGTGGGCTGG + Intronic
985860099 5:2464202-2464224 CCTGAGAGGCAGGTTTTGGCAGG - Intergenic
986337832 5:6768234-6768256 CGAGAGAGGGAGGAGGTGCCAGG - Intergenic
986504023 5:8430311-8430333 CCTGAGAGCACGGGGGTGCCAGG + Intergenic
986585969 5:9318986-9319008 CCTGAGAGGCAGAGGTTGCCAGG + Intronic
987189710 5:15463577-15463599 CCAGAGACAGAGGGGGTGGGTGG - Intergenic
987708154 5:21481493-21481515 CCGGAGTGGGAAGAGGTGGCAGG + Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
988751625 5:34193462-34193484 CCGGAGTGGGAAGAGGTGGCCGG - Intergenic
989052573 5:37335842-37335864 CATGGCGGGGAGGGGGTGGCGGG + Intronic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989956664 5:50368278-50368300 CCTGAGAGTGATGGGGTGAATGG + Intergenic
990306352 5:54497334-54497356 GCTGATAAGGAGGGGATGGCTGG - Intergenic
990527167 5:56639259-56639281 ACTGAGAGAGAGTGGGTAGCAGG - Intergenic
990545210 5:56815522-56815544 CCTGCGAGGGAGGGAGGGGGCGG - Intergenic
991686954 5:69190048-69190070 CCAGAGAGGTAGGGGGAGGGCGG - Intronic
991736768 5:69635389-69635411 CGTGAGTGGGAAGAGGTGGCAGG - Intergenic
991736941 5:69636208-69636230 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991739376 5:69654241-69654263 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991758124 5:69898938-69898960 CCGGAGTGGGAAGAGGTGGCAGG + Intergenic
991788514 5:70215932-70215954 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991790951 5:70233982-70234004 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991813266 5:70491037-70491059 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991816398 5:70512318-70512340 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991818838 5:70530358-70530380 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991837527 5:70774820-70774842 CCGGAGTGGGAAGAGGTGGCAGG + Intergenic
991880962 5:71216296-71216318 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
991883399 5:71234317-71234339 CCGGAGTGGGAAGAGGTGGCAGG - Intergenic
992011795 5:72534858-72534880 TCTGAGAGGGAGCAGGTGTCTGG + Intergenic
995535390 5:113130703-113130725 CCTGAGAGGGATGATGTGCCAGG - Intronic
996284029 5:121767890-121767912 CCAGGGAGGGAAGGGGTTGCAGG - Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997778101 5:136629564-136629586 CCTGGGAGGGAGGGGGTCAAGGG - Intergenic
998003043 5:138639685-138639707 CCTGGTAGGGAGGGGGGAGCAGG - Intronic
998136671 5:139677697-139677719 CCTCAGAGGCTGGGGGTGGGTGG + Intronic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998158159 5:139797629-139797651 ACTGAGAGAGAGAGTGTGGCTGG + Intronic
998216640 5:140242735-140242757 GCTGAGTGGGATGGGGCGGCTGG - Intronic
998366746 5:141637162-141637184 CCTTTGAGGGACGGAGTGGCGGG - Exonic
998679663 5:144452954-144452976 CATGAGCTGGAGGAGGTGGCTGG + Intronic
998754203 5:145358256-145358278 TATGAGAGGGAGGAGGTGGATGG + Intergenic
998768194 5:145512138-145512160 CATGAGAAGAAGGTGGTGGCTGG + Intronic
999234935 5:150084884-150084906 TCTGAGATGAAGGGGGTGGCGGG + Intronic
999561059 5:152803433-152803455 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1000757052 5:165174623-165174645 CCTGGGAGGGCGGAGGTTGCAGG - Intergenic
1000980701 5:167813673-167813695 AGTGAGAGGGAGGGGGAGGTTGG - Intronic
1001313582 5:170627760-170627782 GCTGAGAGGGTGGGGGTAGATGG - Intronic
1001435713 5:171697673-171697695 CCTGAGTGAGAGGGGGTCCCAGG - Intergenic
1001481992 5:172095031-172095053 ACTGAGAAGGACGGGGCGGCAGG - Intronic
1001993372 5:176134866-176134888 GCTGAGGGGGAGGTGGTGGGGGG + Intergenic
1002297293 5:178238808-178238830 ACTGAGAGGGAGTGGGGGGAGGG - Intronic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002360630 5:178667875-178667897 CCAGAGAGGGAGCTGGTGGAAGG + Intergenic
1002434884 5:179225154-179225176 CATGAGAGGGAGGAGGAGCCTGG - Intronic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1002616885 5:180461598-180461620 CCAAAGCAGGAGGGGGTGGCTGG - Intergenic
1002702785 5:181137845-181137867 CCTGAGTGTGAGAGGGTGGCTGG + Intergenic
1002723754 5:181281723-181281745 CCTGAGCGGTAGGCGGGGGCTGG + Intergenic
1002723779 5:181281801-181281823 CCTGAGCGGTAGGCGGGGGCTGG + Intergenic
1002928685 6:1619463-1619485 CCTGAGAGGGGGGAGGGGGATGG - Intergenic
1003233130 6:4272618-4272640 GCTGAGATGGCGGGGGTGGGGGG - Intergenic
1003563665 6:7204302-7204324 ACAGAGAGGGAGGGGGCGGGGGG - Intronic
1004344147 6:14832724-14832746 CCTGAGCAGGAAGGGGTGGGTGG + Intergenic
1004504684 6:16238499-16238521 CCTGAGGCGGAGGCGGTGCCCGG + Intergenic
1004635443 6:17463086-17463108 CCTGAGAGGGAAGGTGTCCCAGG + Intronic
1005105814 6:22223263-22223285 CTTGAGAGGGAGGGAGGGACAGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006338215 6:33431923-33431945 CCTGAGGGGGATGGGGTGGGAGG - Intronic
1006670819 6:35728743-35728765 CCTCGGAGGGAGGGAGAGGCAGG + Intergenic
1006911863 6:37568382-37568404 CAGGAGAGGCAGGGGCTGGCAGG + Intergenic
1007211674 6:40197450-40197472 ACTGTGAGGGAGGTGCTGGCAGG + Intergenic
1007353706 6:41294603-41294625 CCACAGAGGGAGGGTGTGGTGGG - Intergenic
1007737059 6:43988204-43988226 CCTGTGAGGTAGGGGGTCGCAGG + Intergenic
1008056710 6:46953081-46953103 ACTGAGAGGGTGAGGCTGGCAGG + Intronic
1008728199 6:54447119-54447141 TAGGAGAGGAAGGGGGTGGCTGG + Intergenic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1013117748 6:107115381-107115403 GCTGAGGGGGAGGGGCGGGCCGG - Intergenic
1014035739 6:116765356-116765378 CCTGGGAGGGAGGAGGTTGCGGG - Intronic
1014060444 6:117065339-117065361 GGGGGGAGGGAGGGGGTGGCGGG - Intergenic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1015840652 6:137473412-137473434 CCTCAGAGGGAGGGGAGGGGCGG + Intergenic
1015948035 6:138523019-138523041 CATGAAAGGGTGGGGGTGGGGGG - Intronic
1016038052 6:139403410-139403432 GCTGAGAGTGAGGGGGTGGTGGG + Intergenic
1016886937 6:148967664-148967686 CCTCCGAGGGGAGGGGTGGCCGG - Intronic
1016987011 6:149903405-149903427 CGGGAGTGGGTGGGGGTGGCAGG - Intergenic
1017587705 6:155945539-155945561 CGCAAGAGGGAGGGGATGGCAGG - Intergenic
1017651710 6:156589346-156589368 CCTCAGTGGGTGGGGGTGGGGGG - Intergenic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1019150258 6:170000742-170000764 GGTGAGAAGGAGGGGATGGCTGG - Intergenic
1019319595 7:409548-409570 TCTGTTAGGGAGGGGGAGGCTGG - Intergenic
1019472475 7:1228349-1228371 GCTGAGAGGGAGAGGGAGACGGG - Intergenic
1019473072 7:1231488-1231510 CGTGAGAGGGAAGGGCAGGCCGG - Intergenic
1019499556 7:1358193-1358215 CCTGTGAGGGAGTGTGGGGCCGG - Intergenic
1019611784 7:1940442-1940464 CCTGAGTGCGTGTGGGTGGCTGG - Intronic
1019623312 7:2003001-2003023 CCTGGGAGGAAGGGCGAGGCAGG + Intronic
1019746912 7:2705845-2705867 CCTGAGAGGCACGGGGTCCCCGG - Intronic
1019771587 7:2886786-2886808 CCTGAGAGGGAGGGTCTGCCAGG + Intergenic
1019779381 7:2930504-2930526 CCTGGCGGGGAGGGGGTGGTGGG + Intronic
1020433752 7:8140308-8140330 CATGAGGGGGAGCGAGTGGCAGG - Intronic
1021364495 7:19760099-19760121 CCTGAGGGGGAGGAGGTAGAAGG - Intronic
1022067009 7:26869018-26869040 GCAGAGATGGAGGGTGTGGCAGG - Intronic
1022271118 7:28809156-28809178 CCAGAGAGGGAGGAGGTGATGGG - Intronic
1022413187 7:30155182-30155204 CCTGACAGGGAGTGGCTGCCTGG - Intronic
1022413270 7:30155866-30155888 TGAGAGAGGAAGGGGGTGGCAGG + Intronic
1022443691 7:30453039-30453061 CACTGGAGGGAGGGGGTGGCAGG + Exonic
1022689720 7:32636926-32636948 CATTAGAGGGAGGTGGTGGGTGG - Intergenic
1022917289 7:34971105-34971127 CATTAGAGGGAGGTGGTGGGTGG - Intronic
1022964946 7:35464003-35464025 TGTGAGGGGGAGGGGATGGCAGG + Intergenic
1023036526 7:36135948-36135970 CAGGAGAGGCAGTGGGTGGCAGG + Intergenic
1023752352 7:43384762-43384784 CGTGAGAGGGAGTGGGTGGCTGG + Intronic
1024216656 7:47254383-47254405 CCTGCGGGGGAGGGGGTGAGCGG - Intergenic
1024233416 7:47379997-47380019 CCAGAGAGGCAGTGTGTGGCTGG - Intronic
1024407636 7:49000887-49000909 CCTGAGAGAAAGGGTGGGGCTGG - Intergenic
1024658339 7:51471321-51471343 CCTGTGAGGGAGGGGAAGGAGGG - Intergenic
1024979448 7:55145206-55145228 CCTGAGAGAGAGCAGGGGGCGGG - Intronic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026879959 7:73901867-73901889 CCTGAGGGGGAGGGGGAGTTGGG - Intergenic
1026975340 7:74494448-74494470 TCTGAGAGTGAGTGAGTGGCTGG + Intronic
1026977033 7:74505337-74505359 CCTCAGATGGAGGGAGAGGCAGG - Intronic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028198613 7:87934897-87934919 TCCGAGAGGGAGGGGGCGGTGGG + Intronic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1029488009 7:100854796-100854818 CCTGCTAGGGAGGGTGTGGAAGG + Intronic
1029607051 7:101605552-101605574 CCTGAGAGGGAGGGAGTTTAGGG - Intergenic
1031287155 7:119885180-119885202 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1032388085 7:131538294-131538316 CCTGGCAGGGAAGGAGTGGCAGG + Intronic
1032482499 7:132257991-132258013 TCTGAGATGGAGGGTGTAGCTGG + Intronic
1032996724 7:137455203-137455225 CCTGAGAAGGGTGGGGTGGGAGG - Intronic
1033253471 7:139778861-139778883 CCTAAGTTGGAGGGGATGGCAGG - Intronic
1033368776 7:140690679-140690701 GCTGAGAGTGTGGGGGTGGTGGG + Intronic
1033544910 7:142391250-142391272 TGTAAGAGGGTGGGGGTGGCAGG + Intergenic
1034198758 7:149267370-149267392 CCTGGGCAGGAGTGGGTGGCTGG + Intronic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034781391 7:153886075-153886097 CCTGAGGGGAAGGGCATGGCGGG - Intergenic
1035215504 7:157363544-157363566 CCTGGGAGAGAGGAGGTTGCGGG + Intronic
1035759073 8:2055956-2055978 CCTGGGAAGGAGGCGGTGGAGGG - Intronic
1036001118 8:4606056-4606078 CCTGAGAAGGATGCGGTGGTGGG + Intronic
1036498656 8:9293966-9293988 CCTGAGAGTGTGGGGGTGAATGG - Intergenic
1036926887 8:12915837-12915859 CCTGAGCTGGAGGGGTTGGATGG - Intergenic
1037556266 8:20026620-20026642 CCTGTGAGGGAGTGGGGGACTGG - Intergenic
1037819039 8:22126987-22127009 CCTGCGTGGGAGGGGGCAGCCGG - Intronic
1037930644 8:22878181-22878203 CCTGAGGGAAAGGGGGTGGAGGG + Intronic
1037963244 8:23115423-23115445 GCTGAGTGGGAGGGGGTGGGTGG + Intronic
1038067223 8:23975668-23975690 ACTGAGAGGGGTGGGGAGGCAGG - Intergenic
1038084592 8:24180522-24180544 CCTAAGAAGGTGGGGGTGGGGGG + Intergenic
1038190467 8:25315206-25315228 CCTCACAGTGAGGGGGTGTCTGG - Intronic
1038310017 8:26439312-26439334 CCTGAGAGGCAGGAGGTGCTTGG + Intronic
1038732173 8:30137472-30137494 CCTGAGAGGGAGGGCAAAGCAGG - Exonic
1039466879 8:37790801-37790823 CTTGTGAGGGAGGTGGGGGCAGG + Intronic
1039510911 8:38091227-38091249 CCAGAGTGGCTGGGGGTGGCAGG - Intergenic
1040092068 8:43408794-43408816 TATGAGTGGGAGGGGGTGGCTGG + Intergenic
1040291327 8:46126923-46126945 TCTGGAAGGGAGGGGGTGTCTGG - Intergenic
1040400573 8:47045639-47045661 TATGGGTGGGAGGGGGTGGCTGG - Intergenic
1040552151 8:48445871-48445893 CCTGAGACAAAGTGGGTGGCTGG - Intergenic
1041192950 8:55371998-55372020 CCTCAGAGGGAAGGAGAGGCAGG - Intronic
1041532153 8:58881052-58881074 CCTGTGTGGGAGGAGGTGGGGGG + Intronic
1042743527 8:72077265-72077287 CCCGAGAGACAGGGGGTGACAGG + Intronic
1044126736 8:88467850-88467872 CCTGAGTGATAGGGGGTTGCAGG - Intergenic
1044248928 8:89984252-89984274 GCTGGGAGGGAGGGGGAGTCAGG + Intronic
1044858048 8:96495197-96495219 CCAGAGAGGGCGAGCGTGGCGGG - Intronic
1045329491 8:101142931-101142953 CAAGAGAGGGAGGAGGTGCCAGG + Intergenic
1045452533 8:102342409-102342431 CCTTAGAGGGAGGGGTTGTCAGG + Intronic
1045884553 8:107079954-107079976 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1047544005 8:125797736-125797758 CCAGAGAGGGCTGAGGTGGCAGG + Intergenic
1047700958 8:127448972-127448994 GCTGAGTGGGAGGGGGAAGCCGG - Intergenic
1047752203 8:127890319-127890341 CCTGAGAGGGGAGAGGAGGCTGG - Intergenic
1047949966 8:129924290-129924312 CCGGGGGGGGGGGGGGTGGCGGG + Intronic
1048256204 8:132906924-132906946 CCTGAGAGGGAGCGGGGTGCAGG - Intronic
1048810760 8:138283932-138283954 TGTGACAGGGAGGGGCTGGCAGG + Intronic
1048810841 8:138284588-138284610 TGTGACAGGGAGGGGCTGGCAGG - Intronic
1048831080 8:138478158-138478180 CCTGAGATGCAGGGAGTGTCAGG - Intronic
1048985264 8:139731572-139731594 CTTGAGAGGTAGGAGGTGGGAGG + Intronic
1048994718 8:139787293-139787315 CCTGAGCGGGGAGGGGTGGGGGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1049288303 8:141788444-141788466 CATGCTGGGGAGGGGGTGGCTGG - Intergenic
1049398528 8:142413055-142413077 CCTCAGGGGGAGGGCGGGGCTGG + Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049499216 8:142952554-142952576 CCTGTGGCTGAGGGGGTGGCTGG + Intergenic
1049592653 8:143469594-143469616 CCTGGGAGTGCGGTGGTGGCAGG + Intronic
1049732329 8:144185030-144185052 GCTGAGGAGGAGGGGGAGGCAGG + Intronic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050123261 9:2330328-2330350 GGTGAGATGGAGGGGGTGGAGGG - Intergenic
1051618518 9:19029389-19029411 CTTGAGTGGGAGGGGGAGACCGG - Intronic
1051930054 9:22374170-22374192 CCAGAGGGTGAGGGGGTGGAAGG + Intergenic
1052767455 9:32656366-32656388 CCTGAGGGTGAGAGGGTGGGAGG + Intergenic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053157488 9:35791385-35791407 CCTGAGAGTGAGGGAGCGCCCGG + Intergenic
1053427564 9:38020804-38020826 CCTGAAAGTGACGGGGTGGGGGG + Intronic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053667094 9:40324158-40324180 TCTGAGAGGCAGGTGGTGCCAGG - Intronic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053916684 9:42949269-42949291 TCTGAGAGGCAGGTGGTGCCAGG - Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054517516 9:66052125-66052147 TCTGAGAGGCAGGTGGTGCCAGG + Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1054716253 9:68560193-68560215 CCAGAGAGAGATCGGGTGGCAGG - Intergenic
1055830799 9:80376394-80376416 CCAGTGAGCGATGGGGTGGCAGG + Intergenic
1056735130 9:89203070-89203092 CCTAAGAGATAGGGGTTGGCAGG + Intergenic
1057080429 9:92170918-92170940 ACTGAGGGGGAGGGGTGGGCCGG + Intergenic
1057303651 9:93900307-93900329 TCTGGGAGGTTGGGGGTGGCAGG - Intergenic
1057393469 9:94658534-94658556 TGTGAGAGGGAAGGGGTGGAGGG - Intergenic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1059407212 9:114108652-114108674 CCTGGCGGGTAGGGGGTGGCAGG - Intergenic
1059411475 9:114135044-114135066 CCTGAAGGGGAGGGGCTGTCAGG + Intergenic
1060205277 9:121678990-121679012 CCTGAGAGGGAGGGGGCAGGTGG + Intronic
1060442468 9:123654808-123654830 CCTGAGCGGGTGGGAGTGGGTGG + Intronic
1060464713 9:123892904-123892926 CCTGAGAGGCAGGGGTTGCGGGG + Intronic
1060538462 9:124411957-124411979 CCCTAAAGGGAGGGGGTGGGGGG + Intronic
1060554348 9:124500551-124500573 CCGGTGCGGGAGGGGGCGGCGGG + Exonic
1060750752 9:126166898-126166920 GCAGAGAGGGAAGGGATGGCTGG + Intergenic
1060937951 9:127526857-127526879 CCAGTGAGGAAGGAGGTGGCAGG + Intronic
1060988786 9:127836480-127836502 CCTGGGAGGGTGGGGGCTGCAGG - Intronic
1061044970 9:128160111-128160133 ACTGTGAGGGAGGTGGAGGCGGG + Intergenic
1061204348 9:129154483-129154505 CCTGAGAGGGAGTGGGCAGTCGG + Intergenic
1061802373 9:133119669-133119691 CCTGGGAGGGTGGGGGTGGGAGG - Intronic
1061805270 9:133134217-133134239 CCAAAGAGGGAGGGGATGCCAGG - Intronic
1061822349 9:133235594-133235616 CCTGAGTGGTGGGTGGTGGCTGG - Intergenic
1061832306 9:133303846-133303868 CCTGAGTGGCAGGTGGTGTCTGG + Intergenic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062067353 9:134535876-134535898 CCTGAGAGGGAGGGGAATTCTGG + Intergenic
1062115466 9:134805897-134805919 CCTCAAGGGGAGGGGGTGCCAGG + Intronic
1062208170 9:135348638-135348660 CCTGCCAGGGAGGGGGGGGCGGG - Intergenic
1062412207 9:136431253-136431275 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1062412316 9:136431544-136431566 CCTGGGGGGGCGGGCGTGGCGGG - Intronic
1062458748 9:136654123-136654145 GCTGGGAGGTGGGGGGTGGCTGG - Intergenic
1062595259 9:137296325-137296347 CCTGAGTGTGCGGGGGTGGGTGG + Intergenic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1185533291 X:839028-839050 CCTGGGGGGGTGGGGGTGGGGGG + Intergenic
1187026593 X:15441666-15441688 CCTGAGGATGAGGGGGAGGCAGG + Intronic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188709487 X:33377214-33377236 CCTGTGAGCGAGGGGGCTGCTGG - Intergenic
1190331656 X:49239630-49239652 CCTGAGAGCGAAGGGATGGATGG - Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1193637355 X:83968967-83968989 CCTGGCAGGGTGGGGGTGGGTGG - Intergenic
1196174529 X:112626484-112626506 CTTGGGAGTCAGGGGGTGGCGGG - Intergenic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1197767744 X:130069983-130070005 ACTGAGAGTGAGGGGATGGATGG + Intronic
1199207464 X:145165437-145165459 CATGAGAGGGACTTGGTGGCAGG + Intergenic
1199306319 X:146270665-146270687 CAAGGGAGGGATGGGGTGGCAGG + Intergenic
1199548425 X:149032465-149032487 CCAGAGAGGTAGGGGGTTGGTGG - Intergenic
1200088960 X:153625581-153625603 CCAGACTGGGAGGGGGTGGCCGG - Intergenic
1200151313 X:153952718-153952740 ACTGTGTGGGTGGGGGTGGCTGG + Exonic
1200213373 X:154356765-154356787 CATGAGCGGGTGGGGCTGGCTGG - Intronic
1200217418 X:154374219-154374241 CCCGAGAGAGAGAGGGTGTCTGG - Intronic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1201268193 Y:12229145-12229167 GGTGAGAGGGAGATGGTGGCAGG - Intergenic
1201357361 Y:13111853-13111875 CCAGAGTGGCTGGGGGTGGCAGG + Intergenic