ID: 1142698940

View in Genome Browser
Species Human (GRCh38)
Location 17:1648244-1648266
Sequence GGCCTGCGCTGGGAACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 357}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698940_1142698950 23 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698950 17:1648290-1648312 TCAATGACTGGAGAATGAGGTGG 0: 1
1: 0
2: 1
3: 27
4: 250
1142698940_1142698952 25 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698952 17:1648292-1648314 AATGACTGGAGAATGAGGTGGGG 0: 1
1: 0
2: 0
3: 22
4: 336
1142698940_1142698946 -5 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698946 17:1648262-1648284 AGGCCTGGCACATGTCACTGTGG 0: 1
1: 0
2: 1
3: 14
4: 199
1142698940_1142698949 20 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698949 17:1648287-1648309 ATGTCAATGACTGGAGAATGAGG 0: 1
1: 0
2: 0
3: 16
4: 264
1142698940_1142698951 24 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698951 17:1648291-1648313 CAATGACTGGAGAATGAGGTGGG 0: 1
1: 0
2: 1
3: 25
4: 255
1142698940_1142698948 11 Left 1142698940 17:1648244-1648266 CCTCCCAGTTCCCAGCGCAGGCC 0: 1
1: 0
2: 2
3: 34
4: 357
Right 1142698948 17:1648278-1648300 ACTGTGGACATGTCAATGACTGG 0: 1
1: 0
2: 1
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698940 Original CRISPR GGCCTGCGCTGGGAACTGGG AGG (reversed) Intronic
900095148 1:937218-937240 GGCCCGGGCTGGGAACAGGATGG - Intronic
900223653 1:1522892-1522914 GGCCTGCGCTGCTACCTGGATGG - Exonic
900289377 1:1917428-1917450 GCCCTGAGCTGGGCAATGGGTGG - Intergenic
900370881 1:2331578-2331600 GGCCTTGGCTGGGCTCTGGGAGG + Intronic
900641581 1:3690298-3690320 CCCCTGCGCGGGGAACTCGGTGG - Intronic
900653723 1:3744770-3744792 GGCCTGGGCTGGGCACTGCCTGG - Intergenic
900673062 1:3867931-3867953 GGCCTGCCCTGTGGACTTGGGGG + Intronic
900948829 1:5846130-5846152 GGCCTGAGCTGGCGGCTGGGGGG + Intergenic
901066761 1:6497967-6497989 GGCGGGGGCTGGGGACTGGGTGG - Intronic
901459765 1:9384504-9384526 GTCCTGAGCTGGGGACTGGCGGG - Intergenic
901460269 1:9387132-9387154 GTCCTGAGCTGGGGACTGGCGGG - Intergenic
901767837 1:11515227-11515249 TGCCTGTGCTGGGAACAGAGTGG + Intronic
902542590 1:17165405-17165427 GGCATGCTCAGGGAACAGGGTGG - Intergenic
902641157 1:17767207-17767229 GGCCTGCTCTGGAAACAGTGAGG + Intronic
903129449 1:21269042-21269064 GGCCTGGGCTGAGAACTCTGTGG + Intronic
903142271 1:21345678-21345700 GGGCTGCGCGGGGAACCTGGAGG + Intergenic
903167610 1:21531779-21531801 GGCCTGGGCTTGGAACAGAGAGG + Intronic
904091043 1:27945320-27945342 GGCCTGCGTCGGGCACTGGCTGG - Exonic
904289087 1:29472004-29472026 GGCCTGTGCTGGGAAGGGGAGGG + Intergenic
904485911 1:30824508-30824530 GGCCTGCGGTGGGAGCCGCGAGG - Intergenic
905094317 1:35456144-35456166 GGCCTGCGTTGGCCACAGGGGGG + Exonic
906113279 1:43338561-43338583 GGCATGCTCTGGGAACTCAGGGG - Exonic
907274723 1:53310840-53310862 GCCCTGTGATGGGCACTGGGGGG + Intronic
907440605 1:54475909-54475931 GGCCTCCCCTGAGAACTGGGGGG - Intergenic
907507156 1:54927911-54927933 ACCCTGTGCTGGGAACTAGGGGG + Intergenic
909238421 1:73181299-73181321 GGTCTGCGCTGTGGATTGGGCGG + Intergenic
910058481 1:83060406-83060428 GGCCTGAGCTGGCCACTGGTTGG + Intergenic
910676611 1:89821785-89821807 GGGCTGCGCTGGGAGCCCGGCGG + Intronic
911435830 1:97856734-97856756 AGCCTGGGCTGGGTAGTGGGTGG - Intronic
911993653 1:104735732-104735754 AACTTGTGCTGGGAACTGGGAGG + Intergenic
912431401 1:109630213-109630235 GGCCTGGGCAGGCAACAGGGAGG - Exonic
916414062 1:164576493-164576515 GGCCTGCGCTGGGAACTCAAGGG - Intronic
917076034 1:171206173-171206195 GCCCTGTGCTGGGAACTGGTGGG + Intronic
919766085 1:201128039-201128061 GGCCTGTGCTGGGAGCTGGGAGG + Intergenic
920703094 1:208232383-208232405 GGCCAGGGCTGAGAGCTGGGAGG - Intronic
920945734 1:210526890-210526912 GCTCTGTGCTGGAAACTGGGAGG - Intronic
921149127 1:212385872-212385894 TGCCTGGGCTGGGAAGAGGGAGG - Intronic
921972750 1:221168204-221168226 CGCCTGCAGTGGGAAATGGGAGG - Intergenic
922696959 1:227735634-227735656 GGGCTGCGCTGGGAGAGGGGCGG + Intronic
922780624 1:228249873-228249895 GGCCTGGGAGGGGAAGTGGGAGG - Intronic
923391130 1:233515273-233515295 GGCCCGGGGTGGGAAGTGGGAGG + Intergenic
1063652018 10:7947269-7947291 GGCCTGCGGTGGGGGCTGGAGGG - Intronic
1065102046 10:22340862-22340884 GGCCTGAGCTGGGAAAGGCGCGG - Intergenic
1070820216 10:79349962-79349984 GCCCTGCCCGGGGGACTGGGAGG + Intronic
1073123984 10:101138770-101138792 GGCTAGTGCTGGGAACTGGTAGG - Intergenic
1073476439 10:103756811-103756833 GGCCTAGGCTGGGCCCTGGGTGG - Intronic
1074427976 10:113368867-113368889 GGCGTGCTCTGGGGACTGGGAGG - Intergenic
1074595836 10:114866127-114866149 GGCCTGTGCTGGGGGCGGGGTGG - Intronic
1074876249 10:117615773-117615795 GGCATGTGCTGGGGGCTGGGTGG - Intergenic
1075689806 10:124387298-124387320 GCCCTGTGCTGGGGGCTGGGAGG + Intergenic
1076024498 10:127100662-127100684 GCCCTGCGCAGGGAGCTGGAAGG + Intronic
1076608998 10:131708732-131708754 GGCTTGCACTGGGAGCTGGAAGG + Intergenic
1077132237 11:978876-978898 GGCCTGCGCCCGGAGTTGGGTGG + Intronic
1077161067 11:1113143-1113165 GGCCTGCTCTGGGAAGGGGCAGG - Intergenic
1077161086 11:1113189-1113211 GGCCTGCTCTGGGGAAGGGGCGG - Intergenic
1077161106 11:1113235-1113257 GGCCTGCTCTGGGGAAGGGGCGG - Intergenic
1077161126 11:1113281-1113303 GGCCTGCTCTGGGGAAGGGGCGG - Intergenic
1077161146 11:1113327-1113349 GGCCTGCTCTGGGGAAGGGGTGG - Intergenic
1077161166 11:1113373-1113395 GGCCTGCTCTGGGGAAGGGGCGG - Intergenic
1077161186 11:1113419-1113441 GGCCTGCTCTGGGGAAGGGGCGG - Intergenic
1077408410 11:2392713-2392735 TTCCTGCGCCGGGAACAGGGTGG + Intronic
1077412228 11:2408996-2409018 GCCCTGCGGTGGGTTCTGGGGGG + Intronic
1077610616 11:3641546-3641568 TGCCTGCGCTGGGAGATGAGAGG + Intronic
1077637824 11:3855572-3855594 GGGCTTCGCTGGGGACCGGGCGG + Intronic
1077872103 11:6270949-6270971 GGACTGGGCTGGAGACTGGGGGG + Intronic
1078083299 11:8219051-8219073 GGCCTGTGCTGGCTGCTGGGTGG - Intergenic
1078266947 11:9762138-9762160 GTCCTGAGGTGGGAACTGTGTGG + Intergenic
1081591083 11:44423684-44423706 GGCCTGCTTTGGGAAAAGGGAGG - Intergenic
1083635966 11:64121172-64121194 GGCCTGCTCTGTGCAATGGGAGG - Intronic
1083812217 11:65112335-65112357 CGCCTGGGAAGGGAACTGGGAGG + Intronic
1083890184 11:65592103-65592125 GGGCGGCGCTGGGAGTTGGGAGG + Intronic
1084435463 11:69136781-69136803 GCCCTGCCCTGGGACCTTGGTGG + Intergenic
1084561163 11:69906164-69906186 GTCCTGCACTGGAAGCTGGGAGG + Intergenic
1085388718 11:76171485-76171507 GGCCCTCCCTGGGCACTGGGAGG - Intergenic
1085394052 11:76197738-76197760 GCCCAGAGCTGGGATCTGGGAGG - Intronic
1088502506 11:110496873-110496895 GTCCTGTGCTGGGAACTGATTGG + Intergenic
1088893436 11:114061132-114061154 GGGGGTCGCTGGGAACTGGGGGG + Intronic
1089679122 11:120109748-120109770 GGGCTGTGCTGGGAACTGGGCGG - Intergenic
1090666273 11:128916879-128916901 GCCCTGTGCTGGGAGCTGTGAGG - Exonic
1091301243 11:134509601-134509623 GGTCTGCCCTGGGAGCTGGAGGG - Intergenic
1092171405 12:6375852-6375874 GGCCTGGGTGGGGAACCGGGAGG + Intronic
1093461065 12:19407385-19407407 TGCTTGAGCTGGGACCTGGGAGG - Intronic
1094199354 12:27780571-27780593 GGCCCGCGCGGGGAAAAGGGCGG + Exonic
1096675709 12:53224727-53224749 GGCCTGGGCAGGGAAGTGGCAGG - Intronic
1098226405 12:68329679-68329701 GGCCTGTGTTAGGTACTGGGTGG + Intronic
1101308320 12:103553671-103553693 GGGCTGGGGTGGGGACTGGGAGG - Intergenic
1103020662 12:117531344-117531366 GTCCTGAGCTGGGTACTGAGAGG - Intronic
1103217899 12:119217436-119217458 GGAATGCGCTTGGAACTGAGAGG + Intronic
1105005113 12:132716822-132716844 GGACAGCTCTGGGGACTGGGGGG - Intronic
1105888797 13:24666878-24666900 GGCCTGCTTTGGGAACTCGGTGG - Intergenic
1106250899 13:27980710-27980732 GGCCTGCGCGGGGAGCCTGGTGG - Intronic
1110925761 13:81149535-81149557 TCCCTGCGCTGGGGTCTGGGGGG + Intergenic
1113594577 13:111521836-111521858 GGTCGGCACTGGGAACTGGGAGG + Intergenic
1113768450 13:112894632-112894654 GTCCTGCGCTGGGAACTTCGAGG + Intronic
1113839616 13:113351273-113351295 GGCCTGTGCTGGGGGCCGGGAGG - Intronic
1116656929 14:47665553-47665575 GGGCTGCGCTGGGCACTTGTGGG + Intronic
1117156821 14:52950636-52950658 GGCCGGCGCTGCGAATTCGGTGG - Intronic
1117334933 14:54749033-54749055 GCCCTGTGCTGGAAACTGTGGGG + Intronic
1117736288 14:58772118-58772140 GGCATGAGCTGAGAACAGGGTGG - Intergenic
1118838856 14:69496223-69496245 TGCCAGGGCTGGGAAGTGGGTGG - Intronic
1119377760 14:74208435-74208457 GGCCTGGGCTAGAAAATGGGCGG + Intergenic
1120143644 14:80955720-80955742 GACCTGCCCAGGGACCTGGGCGG + Exonic
1120996721 14:90423312-90423334 GGCCTGCGCCGGGCTCTGTGAGG - Intergenic
1122154880 14:99744261-99744283 GACCTGCCCTGGGAGCAGGGAGG - Intronic
1122234242 14:100323057-100323079 GGCCTGGGCTTGGACCTGGAGGG + Intergenic
1122626521 14:103087957-103087979 TCCCTGCCCTGGGGACTGGGTGG + Intergenic
1122783277 14:104152737-104152759 GCCCTGTGCTGGGCACTGGTGGG - Intronic
1122810206 14:104284048-104284070 GGCATGTGCTGGCAGCTGGGAGG + Intergenic
1123037803 14:105478527-105478549 GGCCTGCCCTGGGACCTGCTGGG + Intronic
1123981812 15:25611817-25611839 GGCCTGCTCTGGCATGTGGGAGG + Intergenic
1124247027 15:28079759-28079781 AGCCTGCGCAGGGCACGGGGAGG - Intronic
1124635110 15:31360278-31360300 GGCCTGTGCCGGGAAGAGGGTGG + Intronic
1124832221 15:33160216-33160238 GGCCTAGGCTGGCCACTGGGTGG + Intronic
1125887260 15:43238185-43238207 GGCCAGAGCTGGGATCTGGCTGG - Intronic
1128084791 15:64878340-64878362 GGCCTCCCGTGGGTACTGGGTGG - Intronic
1128240142 15:66096106-66096128 GGCCAGGGCTGGGAGCTGGCTGG - Intronic
1128495788 15:68197785-68197807 GGCCTGTCGTGGGAACTCGGTGG - Intronic
1128521885 15:68380747-68380769 GGCCTGAGGTGGGATCTGGAGGG + Intronic
1129503179 15:76059711-76059733 GGCCTGAGCTGGGCAGGGGGCGG - Intronic
1129616304 15:77101088-77101110 GGGCTGCGATGGGAAGTGGGGGG - Exonic
1129656294 15:77527518-77527540 GGGCTGCAGTGGGAACTGAGGGG + Intergenic
1129676482 15:77634685-77634707 CGCCTGCGCTGGGCTCTGGCAGG - Intronic
1130332754 15:82934498-82934520 TGCATGTGCGGGGAACTGGGAGG - Intronic
1130546836 15:84862961-84862983 GACCTGGGCTGGGAAAGGGGAGG - Intronic
1131849716 15:96525834-96525856 GCCCTGTGCTGGGAATTGGCGGG - Intergenic
1132215276 15:100057668-100057690 GGCCTGTGCCTGGAACTGTGGGG - Intronic
1132463843 16:68588-68610 GGCCTGGGCTGGCAGCTGTGAGG - Intronic
1132651145 16:1021935-1021957 GGCCCGCGCTGGGGTGTGGGAGG - Intergenic
1132657926 16:1048997-1049019 GGCCTGCCCTGAGAACTCCGAGG - Intergenic
1132659545 16:1055271-1055293 GGCCGGCGCTGGCCACTGGGGGG - Intergenic
1132660195 16:1057814-1057836 GTCCGGCGCTGGGCAGTGGGCGG + Intergenic
1132749869 16:1452581-1452603 GGCCTCCTCTGAGATCTGGGTGG + Intronic
1136045209 16:27609977-27609999 GGCCTGAGGTGGGAGCTTGGCGG + Intronic
1136280275 16:29204499-29204521 TGCCGGGGCTGGGAACAGGGGGG - Intergenic
1137291625 16:47055540-47055562 GGCCTGCTCTGTGAAGCGGGAGG + Intergenic
1137718147 16:50611439-50611461 GGCCTGCCCTGGAAGCTGGGAGG - Intronic
1138273066 16:55710002-55710024 GGCCTTCTCTGGGGACAGGGTGG - Intergenic
1138374257 16:56551833-56551855 TGGCTGAGCTGGGAACTGAGGGG + Intergenic
1138521542 16:57574303-57574325 GGCCTGCGCTGGAGAGTGGGCGG - Intronic
1138582858 16:57952943-57952965 GGCCTGCCCTGGGGGCTGTGTGG - Intronic
1139505166 16:67394957-67394979 GTCCTGCTCTGGGAACTCGAGGG - Intronic
1139664520 16:68447105-68447127 GGCCTGCGCCGCGGGCTGGGCGG - Intronic
1141775069 16:86117629-86117651 GGTCTGCGCTGGGACCTCAGGGG - Intergenic
1142094939 16:88234498-88234520 GGTCTGCGCTGCGAGATGGGAGG - Intergenic
1142225011 16:88872954-88872976 GGGCTCTGCTGGGGACTGGGAGG + Intergenic
1142226944 16:88882110-88882132 GGGCTGCGCTGACAGCTGGGAGG + Intronic
1142231368 16:88901721-88901743 GGCCTTCGCTGGGAACCGTGGGG - Intronic
1142306426 16:89288476-89288498 GGCCTGTCCTGGCATCTGGGTGG - Intronic
1142409270 16:89907926-89907948 GGTGGGAGCTGGGAACTGGGAGG - Intronic
1142409302 16:89908017-89908039 GGTGGGAGCTGGGAACTGGGAGG - Intronic
1142409528 16:89908724-89908746 GGCAGGAGCTGGGAGCTGGGAGG - Intronic
1142698940 17:1648244-1648266 GGCCTGCGCTGGGAACTGGGAGG - Intronic
1142986126 17:3696199-3696221 AGCCTCGGCTGGGAGCTGGGCGG + Exonic
1143174907 17:4950032-4950054 GGCCTGGGGTGGGGGCTGGGAGG + Intronic
1144587065 17:16493168-16493190 GCCCTGCGCTGGGACCAGGGCGG - Intergenic
1144948897 17:18983558-18983580 GGTCTGAGCTGGGAACAGTGAGG + Intronic
1145901666 17:28494073-28494095 GGTCAGCCCTGGGAACTTGGAGG - Exonic
1146162916 17:30569674-30569696 GGCCTGCGCAGGGTGCTGGATGG - Intergenic
1146280030 17:31538770-31538792 GGCCTGCACTGGGAGGTGGAGGG - Intergenic
1146382832 17:32344049-32344071 GACCTGTGCTGGGGACTGGTCGG - Intronic
1147587417 17:41660428-41660450 GGCGTCCGCTGGGAGCTGGTGGG - Intergenic
1147670721 17:42175413-42175435 GCCCTGTGCTAGGTACTGGGAGG - Intronic
1147976309 17:44250142-44250164 TGCCTGTGCTGGGAAGAGGGAGG + Exonic
1148760436 17:49997080-49997102 GGCGGGCGCTGGGCGCTGGGGGG - Intergenic
1148873063 17:50669735-50669757 GGCCTGTGCAGGGTACAGGGAGG + Intronic
1150239621 17:63621768-63621790 GCCCTGTGCTGGGCACGGGGAGG + Intergenic
1151931888 17:77237662-77237684 AGCCAGCGCTGGGAACTCAGTGG - Intergenic
1151999316 17:77635398-77635420 GGGCTGCTCTGGGAACAGAGGGG + Intergenic
1152007993 17:77694576-77694598 TGCGTGGGCTGGGAGCTGGGTGG - Intergenic
1152080464 17:78184237-78184259 GGCCTTCGGTGGGAGCTGAGGGG - Intronic
1152245353 17:79182459-79182481 GGCCTGCACTGGGGACAGAGGGG - Intronic
1152334944 17:79695470-79695492 GGGCTGGGCTGGCAACTCGGAGG - Intergenic
1152379152 17:79933489-79933511 GGCCTGTCCTGGGCACGGGGAGG + Exonic
1152407695 17:80107149-80107171 TGGCTGGGCTGGGATCTGGGAGG + Intergenic
1152597540 17:81245264-81245286 GGCCTCCGCTGCGAGCTGGCTGG - Exonic
1152717111 17:81905499-81905521 GGCCTGTGCTGGGCTGTGGGTGG - Intronic
1152744566 17:82032843-82032865 GGCCAGCCCCGGGAGCTGGGGGG + Intronic
1152993924 18:388738-388760 TGCCAGCTCTGGGACCTGGGTGG - Intronic
1154251699 18:12750277-12750299 AGCCTGCTCTGGGAACCCGGGGG + Intergenic
1156266970 18:35497902-35497924 GGCCCGCGCTGGGAAAAAGGTGG - Exonic
1156897668 18:42265038-42265060 TGCCTGGGCTGGGCACTGTGAGG + Intergenic
1157382550 18:47232577-47232599 GGCCTGTGCAGGGAACTCTGGGG - Intronic
1159952668 18:74496469-74496491 GCCCTGAGCTGGGAACGGGCTGG + Intronic
1160425102 18:78773898-78773920 GGCTGGGGCTGGGCACTGGGTGG - Intergenic
1160695101 19:480038-480060 CGTCTGCGATGTGAACTGGGAGG + Intergenic
1160879379 19:1312645-1312667 GGCCTGCTCTGTGACCTGGGAGG + Intergenic
1161041427 19:2112757-2112779 GGGCTGCCCTGGGACCTGGGTGG + Intronic
1161076194 19:2286942-2286964 GGCCAGCCCTGTGAGCTGGGTGG - Intronic
1161221560 19:3120381-3120403 GGGCTGCTCTGGGGACTGGTGGG - Intronic
1161446142 19:4320355-4320377 TGCCAGAGCTGGGAACTAGGGGG + Intronic
1161500434 19:4611530-4611552 GGCCTGAGCTGAGAGCGGGGAGG + Intergenic
1161566815 19:5007035-5007057 GACCTGGGCAGGGACCTGGGCGG + Intronic
1161864267 19:6822144-6822166 GCCCTGCGCTGGGGTCTGCGGGG + Intronic
1163015285 19:14450876-14450898 GGCCTGTGGTGGGAAGTGTGGGG - Exonic
1163414309 19:17176652-17176674 GGCCTAGGGTGGGCACTGGGAGG + Intronic
1163729490 19:18941011-18941033 AGCCTGCGCTGGGAGCGCGGGGG - Intronic
1164634440 19:29782033-29782055 GGCCCGAGCTGGGGACTGAGTGG - Intergenic
1165066508 19:33232319-33232341 GGCCTGGGCAGGGTCCTGGGAGG + Intergenic
1165669440 19:37662989-37663011 TGCCTGTGCTGGGGACTTGGTGG + Intronic
1165908954 19:39212158-39212180 GGCATGCTCTGGGAACTTGCAGG - Intergenic
1166121136 19:40687522-40687544 TGTCTGCGGTGGGAACTGAGTGG - Intronic
1166832160 19:45645363-45645385 GGCCCGGGCTGGGACCGGGGGGG - Exonic
1166885191 19:45956230-45956252 GGGTTGGGGTGGGAACTGGGGGG + Intronic
1166995782 19:46719135-46719157 GGCCTGGGATGGGAACAGGAAGG + Intergenic
1167148132 19:47694671-47694693 GGGCAGCGCTGGGAAGGGGGTGG - Exonic
1167613282 19:50517511-50517533 CGCCCGGGCTGGGACCTGGGTGG + Exonic
1168082449 19:54020234-54020256 GGGCGGGGCTGGGAACAGGGTGG - Intergenic
1168146005 19:54420489-54420511 AGCCGGGGCTGGGAACCGGGAGG + Intronic
1168146841 19:54424392-54424414 GGCATGCGCTGAGATTTGGGAGG + Intronic
1168179897 19:54654819-54654841 GGACTGAGCTGGGAGATGGGAGG - Intronic
1168309021 19:55451552-55451574 GGGCGGCGCAGGGATCTGGGCGG - Intergenic
1168647835 19:58072347-58072369 GGCCTCAGCTGGGAACTTGAAGG - Intronic
1168724048 19:58571007-58571029 GGGCTGCGCCGGGAGCCGGGCGG - Exonic
925067286 2:938299-938321 ATCCTGCCCTGTGAACTGGGAGG - Intergenic
927459442 2:23285251-23285273 GCCCTGGCCTGGGAGCTGGGAGG - Intergenic
927702570 2:25277323-25277345 GCCCTGGCCTGGGAACGGGGAGG - Intronic
927713835 2:25340945-25340967 GGCCCGCGGTGGGGACAGGGAGG + Intronic
927850205 2:26494098-26494120 GCCCTGGGCTGGAAGCTGGGTGG + Intronic
927863273 2:26573652-26573674 GGCCTCCGCGGGGAACTCAGGGG + Intronic
927886371 2:26721165-26721187 GGCCTGTGCTGGACACTGAGGGG + Intronic
929573566 2:43038763-43038785 GGCCTGAGCTGGGGACGGTGGGG - Intergenic
930053422 2:47234467-47234489 GGCCTGGTCAGGGAACTGAGAGG + Intergenic
932176570 2:69608267-69608289 GGCCTGGGCAGGGAGCTGGGTGG - Intronic
935732666 2:106077148-106077170 GCCCTGTGCTGGGCACTGGAGGG - Intronic
938140379 2:128790211-128790233 GGCCTGGACTTGGAACTTGGAGG - Intergenic
939680399 2:145124034-145124056 TGCCTGGGGTGGGAATTGGGTGG + Intergenic
944667274 2:201968460-201968482 GGCCTGGGTTGGGAACAGTGTGG - Intergenic
946727099 2:222671674-222671696 GCCCCGCGCTGGGCACTGGCTGG - Intergenic
948316640 2:237032263-237032285 GCCCTGAGCTGGGAGCTCGGGGG - Intergenic
948482084 2:238256580-238256602 GGCCTGCCCAGGGAAGAGGGAGG + Intronic
948669936 2:239561752-239561774 GGCCTGCACTGGGCAGTGGGTGG + Intergenic
948762799 2:240203089-240203111 GGCCTGAGCTGGAATCTGGAAGG + Intergenic
948790018 2:240372264-240372286 GGCCTGGGCTGGGAACAAGGAGG + Intergenic
948902671 2:240964275-240964297 GGCCGGCACCGGGACCTGGGTGG + Intronic
949059799 2:241950047-241950069 GGCCTGTGCTGGAGGCTGGGAGG + Intergenic
1169727671 20:8753565-8753587 GGACTGTGCTGGGAACTCGGTGG - Intronic
1171151018 20:22826578-22826600 GGCCTGTCCTGGCAAGTGGGAGG + Intergenic
1171206931 20:23288619-23288641 GGCCTGTGAGGGGCACTGGGAGG - Intergenic
1171371228 20:24663537-24663559 GGCCTGGGCTGGGCTCTGGGGGG - Intronic
1172189485 20:33053544-33053566 GGCCTTCGCTGGGGAAGGGGTGG + Intergenic
1173339385 20:42139856-42139878 GCCCTGTGATGGGCACTGGGAGG - Intronic
1174302874 20:49594907-49594929 GGGCAGAGCTGGGAACAGGGCGG + Intergenic
1174396465 20:50250030-50250052 GGTCTGCTCTGGGAACCAGGAGG - Intergenic
1174845913 20:53943081-53943103 GGGCTGCCCTGGGAGGTGGGGGG - Intronic
1175964631 20:62654398-62654420 GGCCTGCGCTGGGGCTGGGGTGG - Intronic
1175992627 20:62797024-62797046 GGGCTGCCCTGGGGACTGGAGGG - Intronic
1175997019 20:62816557-62816579 GGGCTGCGCTGGGCACTGACCGG + Intronic
1176025460 20:62983200-62983222 GGCCTGTACTGGGGACAGGGAGG - Intergenic
1176234823 20:64049344-64049366 GGACTGCGCTGCGGGCTGGGCGG + Exonic
1178894978 21:36550635-36550657 GACCTAAGATGGGAACTGGGAGG - Intronic
1178918482 21:36722879-36722901 GGCCTTGGCTGAGATCTGGGTGG - Intronic
1180011412 21:45053902-45053924 GGCCTGGGCTGGGTACAGGGAGG + Intergenic
1181695242 22:24589738-24589760 GCCCAGGGCTGGGGACTGGGAGG - Intronic
1182081710 22:27533966-27533988 GGTCTGGGCTGGGCACCGGGTGG - Intergenic
1182283656 22:29231901-29231923 GCTCTGAGCTGGGCACTGGGTGG + Intronic
1182426445 22:30275718-30275740 GGCCTGGGTTGAGAAATGGGTGG - Intergenic
1182494115 22:30694526-30694548 GAGCTGCGCTGGGAGCTGGCGGG + Intronic
1182903970 22:33920795-33920817 GCCCGGCGCTCGGAGCTGGGCGG + Intronic
1183498688 22:38165094-38165116 GGAGTGAGCTGGGAAGTGGGAGG - Intronic
1183507790 22:38219073-38219095 GTCCTGGGTTGGGAACTGGCTGG + Intergenic
1183687063 22:39367282-39367304 GCCCTGCCCTGGGGCCTGGGAGG - Intronic
1184241359 22:43212713-43212735 GGCCTGGGGTGGGGACGGGGTGG + Intronic
1184539666 22:45112408-45112430 GGCCTGGGCTTGGAACTGGAAGG - Intergenic
1184664682 22:45982044-45982066 AGCCTTCTCTGGGAACTGTGGGG - Intergenic
1185071241 22:48657839-48657861 GGCCTGAGCTGGGAGCAGAGAGG + Intronic
950559787 3:13714803-13714825 GGGCTGCGGAGGGAACTGTGTGG + Intergenic
950656558 3:14440481-14440503 GGCATGTGCTGGGACCTGGTGGG + Intronic
950836112 3:15920566-15920588 GGCATGAGCTGGGAACTTGGTGG + Intergenic
951898423 3:27633061-27633083 GGCCTGCAGCGGGAGCTGGGCGG + Intergenic
953573068 3:44087849-44087871 GGTCTGTGCCAGGAACTGGGAGG + Intergenic
953611653 3:44451802-44451824 GGCCTGGGGTGGGAGCTGAGGGG - Intronic
954636700 3:52074818-52074840 GCCCTGCCCTGGGGAATGGGAGG - Intergenic
954698888 3:52441547-52441569 GGCCTGCCCCTGGAACTGGCAGG - Intronic
954708950 3:52495538-52495560 GGCCAGCGGTGGGAACAGGGAGG + Intronic
955632410 3:60988661-60988683 GGCATGGGCTGGGAACCTGGAGG + Intronic
956675911 3:71731557-71731579 GCCCTGCACTAGGCACTGGGTGG - Intronic
956979050 3:74614872-74614894 GGCCTCCGCAGGGCCCTGGGCGG + Intergenic
961958172 3:130825839-130825861 GTCCTCCTCTGGGAATTGGGAGG + Intergenic
962383521 3:134915074-134915096 GGCCTGTGCTGGGAGCTTGGGGG - Intronic
962677542 3:137768081-137768103 CTCCTGCGCTGGGATCTGCGAGG - Intergenic
965249021 3:166317991-166318013 GGCCTGTCCTGGGTACTGTGAGG - Intergenic
965596748 3:170418686-170418708 GGACTGCGCTGCGGACGGGGTGG + Intergenic
966201131 3:177360177-177360199 GGCCTGAACTGGGAGCTTGGCGG + Intergenic
966888452 3:184389458-184389480 GGCCTGAGCTGGGGAAGGGGTGG + Exonic
967826641 3:193882493-193882515 GGCCTAAGCTGGGATATGGGAGG - Intergenic
968173464 3:196528875-196528897 CGCCTCCGCGGGGAGCTGGGCGG + Intergenic
968225562 3:196969937-196969959 GGGCTGCGCTGAGAGCGGGGTGG + Intergenic
968549468 4:1214732-1214754 GCCCTGAGCTGAGGACTGGGCGG + Intronic
968648038 4:1749540-1749562 GGGCAGGGCTGGGGACTGGGAGG + Intergenic
968971300 4:3796730-3796752 GTCCTGCACAGGGAATTGGGGGG + Intergenic
969374290 4:6753089-6753111 GCCCTGCGGGGGGACCTGGGTGG + Intergenic
969457781 4:7309966-7309988 AGCAGGCGCTGGGAAATGGGGGG + Intronic
969621446 4:8280891-8280913 AGCCTGAGCTGGGACCTAGGGGG - Intronic
972694719 4:41434203-41434225 GGCTTAGGCTAGGAACTGGGTGG + Intronic
975485778 4:74933208-74933230 GGGCTGCGGTGGGAGCCGGGAGG - Exonic
975703192 4:77086272-77086294 GGCCTGTTCTGGGATCGGGGTGG - Intergenic
976475200 4:85475334-85475356 CGCCTGCGATGGGAAGTTGGGGG - Exonic
977918677 4:102620707-102620729 GGCCAGCACTGAGATCTGGGAGG - Intergenic
980282268 4:130737019-130737041 GGCCTGAGCCTGGAACTGGCAGG + Intergenic
985073632 4:186191719-186191741 GGTCCGCGCGGGGAAGTGGGCGG + Exonic
985785033 5:1888883-1888905 GGCCTGCTCTGGCAGCAGGGAGG + Intergenic
990919318 5:60945228-60945250 TGGCAGCGCTGGAAACTGGGTGG + Exonic
992625701 5:78634271-78634293 GGCAGGCCCTGGGAACTGAGTGG - Intronic
996168709 5:120260796-120260818 GCCCTTGACTGGGAACTGGGAGG + Intergenic
997222552 5:132181297-132181319 GGCCTGCGCGGGGGAAGGGGTGG + Intergenic
997266846 5:132499866-132499888 GGCCTACGCTGGGCCCTGTGAGG + Intergenic
999136025 5:149319796-149319818 GTCCAGCCCTGGGCACTGGGAGG + Intronic
1001065873 5:168534760-168534782 GCCCTGTGCTGGGAGCTGGGGGG + Intergenic
1001383147 5:171316923-171316945 AGCAGGCGCTTGGAACTGGGGGG - Intergenic
1002580946 5:180209155-180209177 GGGCTGCGCTGGGAGCCGGGCGG - Intergenic
1002643523 5:180641619-180641641 GGCCTCTGCAGGGACCTGGGGGG + Intronic
1003054480 6:2805945-2805967 TGCCTGGGCTGGGTACTGAGGGG + Intergenic
1003105079 6:3209288-3209310 GGCATCAGCTGGGAACTTGGTGG + Intergenic
1003552002 6:7108382-7108404 GGCTCGCGCTGGGAGCTGGTTGG - Intronic
1004413115 6:15400180-15400202 GGCCTGCGCAGGGCAGGGGGAGG + Intronic
1005926325 6:30448523-30448545 TGCCTGCCCAGGAAACTGGGTGG + Intergenic
1006392118 6:33764543-33764565 GGCCTGAGGTGGGGAGTGGGTGG - Intergenic
1006502896 6:34469402-34469424 GGTCTGGGCTGGGGACTTGGCGG + Intronic
1007406877 6:41640390-41640412 GGCCAGCGTGGGCAACTGGGAGG + Intronic
1007615357 6:43176560-43176582 GGCCTGCACTGGGACCTGCTGGG - Exonic
1007916268 6:45564648-45564670 GTCCTGGGCTGGGATCGGGGTGG + Intronic
1011693150 6:89887993-89888015 GCCCTGTGCTGGGGCCTGGGAGG + Intergenic
1017030365 6:150215796-150215818 GTCCTCACCTGGGAACTGGGGGG - Intronic
1017302216 6:152875041-152875063 GGGCTGCTCTGGGAATAGGGTGG + Intergenic
1017818650 6:158033075-158033097 GGCCTGCGATGAAAACTGTGGGG + Intronic
1018454701 6:163941513-163941535 GGCCAGTGCTGGGAACTGGCAGG + Intergenic
1018892677 6:167994016-167994038 GGGCTGCAGTGGGAGCTGGGAGG - Intergenic
1018987041 6:168645737-168645759 GGCCTGCGTGGTGACCTGGGGGG - Intronic
1019159915 6:170062880-170062902 GGCCGGAGCTGGGAGCTGGGAGG - Intergenic
1019187247 6:170227892-170227914 GGCCTGCCCTGGAAACTGCCTGG - Intergenic
1019212943 6:170421370-170421392 GGCGTGCGCTGTGAGCCGGGTGG + Intergenic
1019212975 6:170421502-170421524 CGCGTGCGCTGTGAACCGGGTGG + Intergenic
1019371652 7:665132-665154 GGCCTGCGCCTGGAGCTGCGGGG - Intronic
1020085298 7:5307116-5307138 GGGGTGTGCTGGGGACTGGGAGG + Exonic
1021031858 7:15747065-15747087 TGCCTGAGCTGGGAATGGGGAGG + Intergenic
1021625585 7:22589947-22589969 AGCCAGCACTGGGAGCTGGGAGG + Intronic
1022028167 7:26467775-26467797 GGGCTGAGCTGGGAGCTGGTGGG - Intergenic
1023196185 7:37642032-37642054 GGCCAGCACTGGAGACTGGGAGG - Intergenic
1023840777 7:44096405-44096427 GGCCTGCGCTGAGAAGAGGGTGG - Intergenic
1023972241 7:45000119-45000141 GGCCTGCGCTGGGGAAGGTGGGG + Intronic
1026858707 7:73770898-73770920 GGCCAGCGATGGGAACTGGAGGG - Intergenic
1026909339 7:74083536-74083558 GGCCTCGGCTGGGAGCTGCGAGG - Intronic
1026929337 7:74215271-74215293 TGCCTGTGGTGGGAGCTGGGAGG - Intronic
1030511994 7:110494054-110494076 GGCCTGGGGATGGAACTGGGGGG - Intergenic
1033732805 7:144195574-144195596 GGCCGGCGCCGGGACCTGGAGGG - Exonic
1033743656 7:144294154-144294176 GGCCGGCGCCGGGACCTGGAGGG - Intergenic
1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG + Exonic
1034461367 7:151199700-151199722 GGGCTGGGCTGGGGACTGGAGGG - Intronic
1034641381 7:152606493-152606515 TGCCTGAACTGGGACCTGGGAGG + Intergenic
1036415623 8:8545274-8545296 TGCCTGGGATGGGAACTTGGGGG - Intergenic
1036600084 8:10252644-10252666 GGCCTGGGCTGGGGACTGCCTGG + Intronic
1036910743 8:12755326-12755348 GGCCGGTTCTGGGAAGTGGGCGG - Exonic
1037734192 8:21554035-21554057 GGCAGGAGCTGGGAGCTGGGAGG - Intergenic
1037992153 8:23328650-23328672 TGCCTGGCCTGGGAACAGGGTGG - Intronic
1038483158 8:27915360-27915382 GGACTCTGCTGGGAAGTGGGTGG - Intronic
1038516116 8:28188898-28188920 GGACTGAGCTCAGAACTGGGGGG + Intronic
1038597351 8:28900163-28900185 TGCTTGAACTGGGAACTGGGAGG + Intronic
1040039029 8:42897395-42897417 GGGCTGGGCTGGGAACGCGGCGG + Intronic
1044931834 8:97259159-97259181 GGTCTGTGCTGGGACCTGGCAGG - Intergenic
1045326477 8:101121228-101121250 GGGCTGCACTTGGAACTGGGTGG - Intergenic
1047782895 8:128124161-128124183 GCCCTGAGGTGGGCACTGGGGGG - Intergenic
1048553988 8:135457643-135457665 CGCCGGCGCTGGGTACTCGGCGG + Exonic
1049247330 8:141569787-141569809 GGCCTGTGATGGGTGCTGGGGGG - Intergenic
1049275660 8:141718911-141718933 GGTTTGTGATGGGAACTGGGAGG + Intergenic
1049376493 8:142291854-142291876 GGCCTGCCCAGGGAACTGTGAGG + Intronic
1049431720 8:142568461-142568483 GGCCTGGGATGGGGACTGCGTGG - Intergenic
1049494529 8:142923513-142923535 GGCCTGGGCTAGGGGCTGGGGGG + Intergenic
1049743221 8:144250870-144250892 GCCCTTTGCTGGGAGCTGGGAGG - Intronic
1049760006 8:144327658-144327680 GGCCCACGTTGGAAACTGGGAGG - Intergenic
1050327285 9:4509669-4509691 GTCCTGCTCTGTGCACTGGGAGG - Intronic
1053272687 9:36761156-36761178 GTCCTGCACTGGGAACACGGGGG + Intergenic
1056773308 9:89495352-89495374 GGCCTTCCCTGGAAGCTGGGTGG - Intronic
1057032171 9:91784179-91784201 GGCCTTAGCTGGGAGCAGGGTGG - Intronic
1057294840 9:93828778-93828800 AGCCTGCGCCGTGGACTGGGGGG + Intergenic
1057546015 9:96021062-96021084 CGCCTGCGCCGGGCACAGGGAGG + Intergenic
1057897136 9:98918077-98918099 GGGCTGTTCTGGGAGCTGGGTGG + Intergenic
1059677708 9:116555533-116555555 GGCCTGGGGTGGGGACGGGGTGG - Intronic
1060417170 9:123439123-123439145 GGCCTGAGCCTGGAGCTGGGGGG + Intronic
1060828511 9:126699834-126699856 AGCCTTGGCTGGGAGCTGGGCGG + Exonic
1061260950 9:129480880-129480902 TGCCTGGGCTGGGCACTGGTGGG + Intergenic
1061613290 9:131762715-131762737 GGACCTCGCTGGGAACTGGGTGG + Intergenic
1061933353 9:133844552-133844574 GGCCTGACCTGGCAGCTGGGTGG - Intronic
1062031893 9:134365544-134365566 GGGCTGCACTGGGGCCTGGGTGG + Intronic
1188994515 X:36866815-36866837 GGCATGAGCTGGGATCTGGCTGG - Intergenic
1196886422 X:120250728-120250750 GGCCTGCGCTCGGAAGAGGAGGG + Intergenic
1198801460 X:140452089-140452111 GACCTGGGCTAGGAGCTGGGGGG + Intergenic
1199586747 X:149423136-149423158 GGCTTGAGCTGGGGACTGGAAGG - Intergenic
1200094396 X:153650400-153650422 GGCCTGAGCAGGGTGCTGGGGGG + Exonic
1200137547 X:153882371-153882393 GGCCTGTGCTGGGAAGGGGTGGG - Intronic
1200155161 X:153971255-153971277 GGCCAGTGCTGGGGACTTGGGGG - Exonic
1200240049 X:154488653-154488675 GGCCTGGCCTGGGTACTGGCTGG + Exonic
1200989215 Y:9334271-9334293 GGGAAGCGCTGGGAACTGAGAGG - Intergenic
1201857762 Y:18564319-18564341 TGCCAGCGCTGGTTACTGGGTGG - Intronic
1201875559 Y:18756062-18756084 TGCCAGCGCTGGTTACTGGGTGG + Intronic