ID: 1142698987

View in Genome Browser
Species Human (GRCh38)
Location 17:1648472-1648494
Sequence CGGAGGCCGCGCAGCAGCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698987_1142698997 15 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698987_1142698991 -7 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698991 17:1648488-1648510 GCCTCCGCCTTTGGAAGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 300
1142698987_1142698998 19 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698998 17:1648514-1648536 AGTCAGAGGGTCGCCTCGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 52
1142698987_1142698996 6 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698996 17:1648501-1648523 GAAGGACAGGCACAGTCAGAGGG 0: 1
1: 0
2: 4
3: 28
4: 360
1142698987_1142698995 5 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698995 17:1648500-1648522 GGAAGGACAGGCACAGTCAGAGG 0: 1
1: 0
2: 3
3: 31
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698987 Original CRISPR CGGAGGCCGCGCAGCAGCTC GGG (reversed) Exonic