ID: 1142698988

View in Genome Browser
Species Human (GRCh38)
Location 17:1648473-1648495
Sequence GCGGAGGCCGCGCAGCAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698988_1142698997 14 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698988_1142698998 18 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698998 17:1648514-1648536 AGTCAGAGGGTCGCCTCGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 52
1142698988_1142698996 5 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698996 17:1648501-1648523 GAAGGACAGGCACAGTCAGAGGG 0: 1
1: 0
2: 4
3: 28
4: 360
1142698988_1142698995 4 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698995 17:1648500-1648522 GGAAGGACAGGCACAGTCAGAGG 0: 1
1: 0
2: 3
3: 31
4: 376
1142698988_1142698991 -8 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698991 17:1648488-1648510 GCCTCCGCCTTTGGAAGGACAGG 0: 1
1: 0
2: 0
3: 11
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698988 Original CRISPR GCGGAGGCCGCGCAGCAGCT CGG (reversed) Exonic