ID: 1142698993

View in Genome Browser
Species Human (GRCh38)
Location 17:1648492-1648514
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698993_1142699000 16 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699000 17:1648531-1648553 GGCTGGCGTTCCCCCGCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1142698993_1142699003 26 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319
1142698993_1142699001 17 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699001 17:1648532-1648554 GCTGGCGTTCCCCCGCCCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 115
1142698993_1142698997 -5 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698993_1142699005 27 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185
1142698993_1142698998 -1 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142698998 17:1648514-1648536 AGTCAGAGGGTCGCCTCGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698993 Original CRISPR TGTGCCTGTCCTTCCAAAGG CGG (reversed) Exonic