ID: 1142698997

View in Genome Browser
Species Human (GRCh38)
Location 17:1648510-1648532
Sequence GCACAGTCAGAGGGTCGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698988_1142698997 14 Left 1142698988 17:1648473-1648495 CCGAGCTGCTGCGCGGCCTCCGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698992_1142698997 -2 Left 1142698992 17:1648489-1648511 CCTCCGCCTTTGGAAGGACAGGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698994_1142698997 -8 Left 1142698994 17:1648495-1648517 CCTTTGGAAGGACAGGCACAGTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698993_1142698997 -5 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698987_1142698997 15 Left 1142698987 17:1648472-1648494 CCCGAGCTGCTGCGCGGCCTCCG 0: 1
1: 0
2: 0
3: 13
4: 178
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698984_1142698997 28 Left 1142698984 17:1648459-1648481 CCTCCGAGGGGCGCCCGAGCTGC 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91
1142698985_1142698997 25 Left 1142698985 17:1648462-1648484 CCGAGGGGCGCCCGAGCTGCTGC 0: 1
1: 0
2: 2
3: 13
4: 165
Right 1142698997 17:1648510-1648532 GCACAGTCAGAGGGTCGCCTCGG 0: 1
1: 0
2: 0
3: 8
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698997 Original CRISPR GCACAGTCAGAGGGTCGCCT CGG Intronic