ID: 1142698999

View in Genome Browser
Species Human (GRCh38)
Location 17:1648527-1648549
Sequence GGGCGGGGGAACGCCAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698999_1142699017 26 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699017 17:1648576-1648598 AAGTGACGGGCCGGGAGACTTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1142698999_1142699016 18 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699016 17:1648568-1648590 GCTAGAGGAAGTGACGGGCCGGG 0: 1
1: 0
2: 0
3: 13
4: 134
1142698999_1142699005 -8 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185
1142698999_1142699011 3 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699011 17:1648553-1648575 GGCCATCATGGGAATGCTAGAGG 0: 1
1: 0
2: 0
3: 6
4: 81
1142698999_1142699019 28 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699019 17:1648578-1648600 GTGACGGGCCGGGAGACTTGGGG 0: 1
1: 0
2: 0
3: 3
4: 94
1142698999_1142699014 13 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699014 17:1648563-1648585 GGAATGCTAGAGGAAGTGACGGG 0: 1
1: 0
2: 1
3: 16
4: 212
1142698999_1142699020 29 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699020 17:1648579-1648601 TGACGGGCCGGGAGACTTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 100
1142698999_1142699018 27 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699018 17:1648577-1648599 AGTGACGGGCCGGGAGACTTGGG 0: 1
1: 0
2: 0
3: 5
4: 89
1142698999_1142699013 12 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699013 17:1648562-1648584 GGGAATGCTAGAGGAAGTGACGG 0: 1
1: 0
2: 1
3: 28
4: 436
1142698999_1142699003 -9 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319
1142698999_1142699015 17 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699015 17:1648567-1648589 TGCTAGAGGAAGTGACGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142698999 Original CRISPR GGGCGGGGGAACGCCAGCCG AGG (reversed) Intronic