ID: 1142699000

View in Genome Browser
Species Human (GRCh38)
Location 17:1648531-1648553
Sequence GGCTGGCGTTCCCCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698993_1142699000 16 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699000 17:1648531-1648553 GGCTGGCGTTCCCCCGCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1142698994_1142699000 13 Left 1142698994 17:1648495-1648517 CCTTTGGAAGGACAGGCACAGTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142699000 17:1648531-1648553 GGCTGGCGTTCCCCCGCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 190
1142698992_1142699000 19 Left 1142698992 17:1648489-1648511 CCTCCGCCTTTGGAAGGACAGGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1142699000 17:1648531-1648553 GGCTGGCGTTCCCCCGCCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699000 Original CRISPR GGCTGGCGTTCCCCCGCCCC AGG Intronic