ID: 1142699003

View in Genome Browser
Species Human (GRCh38)
Location 17:1648541-1648563
Sequence CCCCCGCCCCAGGGCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 319}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698993_1142699003 26 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319
1142698994_1142699003 23 Left 1142698994 17:1648495-1648517 CCTTTGGAAGGACAGGCACAGTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319
1142698999_1142699003 -9 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319
1142698992_1142699003 29 Left 1142698992 17:1648489-1648511 CCTCCGCCTTTGGAAGGACAGGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1142699003 17:1648541-1648563 CCCCCGCCCCAGGGCCATCATGG 0: 1
1: 0
2: 0
3: 39
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699003 Original CRISPR CCCCCGCCCCAGGGCCATCA TGG Intronic