ID: 1142699005

View in Genome Browser
Species Human (GRCh38)
Location 17:1648542-1648564
Sequence CCCCGCCCCAGGGCCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 185}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142698994_1142699005 24 Left 1142698994 17:1648495-1648517 CCTTTGGAAGGACAGGCACAGTC 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185
1142698992_1142699005 30 Left 1142698992 17:1648489-1648511 CCTCCGCCTTTGGAAGGACAGGC 0: 1
1: 0
2: 1
3: 12
4: 109
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185
1142698999_1142699005 -8 Left 1142698999 17:1648527-1648549 CCTCGGCTGGCGTTCCCCCGCCC 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185
1142698993_1142699005 27 Left 1142698993 17:1648492-1648514 CCGCCTTTGGAAGGACAGGCACA 0: 1
1: 0
2: 2
3: 19
4: 180
Right 1142699005 17:1648542-1648564 CCCCGCCCCAGGGCCATCATGGG 0: 1
1: 0
2: 2
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699005 Original CRISPR CCCCGCCCCAGGGCCATCAT GGG Intronic