ID: 1142699234

View in Genome Browser
Species Human (GRCh38)
Location 17:1649386-1649408
Sequence AGCGCAGCCCCGGCCAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 377}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142699234_1142699241 9 Left 1142699234 17:1649386-1649408 CCTGCCCTGGCCGGGGCTGCGCT 0: 1
1: 0
2: 2
3: 32
4: 377
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699234_1142699245 12 Left 1142699234 17:1649386-1649408 CCTGCCCTGGCCGGGGCTGCGCT 0: 1
1: 0
2: 2
3: 32
4: 377
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699234 Original CRISPR AGCGCAGCCCCGGCCAGGGC AGG (reversed) Intronic