ID: 1142699241

View in Genome Browser
Species Human (GRCh38)
Location 17:1649418-1649440
Sequence GCCCCGCGCGCAGCTCCCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 180}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142699236_1142699241 4 Left 1142699236 17:1649391-1649413 CCTGGCCGGGGCTGCGCTTACCC 0: 1
1: 1
2: 0
3: 10
4: 149
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699232_1142699241 13 Left 1142699232 17:1649382-1649404 CCGCCCTGCCCTGGCCGGGGCTG 0: 1
1: 0
2: 12
3: 76
4: 749
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699235_1142699241 5 Left 1142699235 17:1649390-1649412 CCCTGGCCGGGGCTGCGCTTACC 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699237_1142699241 -1 Left 1142699237 17:1649396-1649418 CCGGGGCTGCGCTTACCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699225_1142699241 30 Left 1142699225 17:1649365-1649387 CCCGAGCAGGTCGTCACCCGCCC 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699226_1142699241 29 Left 1142699226 17:1649366-1649388 CCGAGCAGGTCGTCACCCGCCCT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699233_1142699241 10 Left 1142699233 17:1649385-1649407 CCCTGCCCTGGCCGGGGCTGCGC 0: 1
1: 0
2: 0
3: 34
4: 367
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699231_1142699241 14 Left 1142699231 17:1649381-1649403 CCCGCCCTGCCCTGGCCGGGGCT 0: 1
1: 0
2: 11
3: 133
4: 1092
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180
1142699234_1142699241 9 Left 1142699234 17:1649386-1649408 CCTGCCCTGGCCGGGGCTGCGCT 0: 1
1: 0
2: 2
3: 32
4: 377
Right 1142699241 17:1649418-1649440 GCCCCGCGCGCAGCTCCCTGCGG 0: 1
1: 0
2: 4
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699241 Original CRISPR GCCCCGCGCGCAGCTCCCTG CGG Exonic