ID: 1142699245

View in Genome Browser
Species Human (GRCh38)
Location 17:1649421-1649443
Sequence CCGCGCGCAGCTCCCTGCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142699235_1142699245 8 Left 1142699235 17:1649390-1649412 CCCTGGCCGGGGCTGCGCTTACC 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699236_1142699245 7 Left 1142699236 17:1649391-1649413 CCTGGCCGGGGCTGCGCTTACCC 0: 1
1: 1
2: 0
3: 10
4: 149
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699231_1142699245 17 Left 1142699231 17:1649381-1649403 CCCGCCCTGCCCTGGCCGGGGCT 0: 1
1: 0
2: 11
3: 133
4: 1092
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699233_1142699245 13 Left 1142699233 17:1649385-1649407 CCCTGCCCTGGCCGGGGCTGCGC 0: 1
1: 0
2: 0
3: 34
4: 367
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699232_1142699245 16 Left 1142699232 17:1649382-1649404 CCGCCCTGCCCTGGCCGGGGCTG 0: 1
1: 0
2: 12
3: 76
4: 749
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699237_1142699245 2 Left 1142699237 17:1649396-1649418 CCGGGGCTGCGCTTACCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 202
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120
1142699234_1142699245 12 Left 1142699234 17:1649386-1649408 CCTGCCCTGGCCGGGGCTGCGCT 0: 1
1: 0
2: 2
3: 32
4: 377
Right 1142699245 17:1649421-1649443 CCGCGCGCAGCTCCCTGCGGAGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699245 Original CRISPR CCGCGCGCAGCTCCCTGCGG AGG Exonic