ID: 1142699750

View in Genome Browser
Species Human (GRCh38)
Location 17:1651676-1651698
Sequence CACCAGACCGTGCACCTGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 194}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142699750_1142699758 27 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699758 17:1651726-1651748 GCAGCGGATCTCCTTCACCTGGG 0: 1
1: 0
2: 0
3: 2
4: 94
1142699750_1142699760 29 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699760 17:1651728-1651750 AGCGGATCTCCTTCACCTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 89
1142699750_1142699759 28 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699759 17:1651727-1651749 CAGCGGATCTCCTTCACCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 76
1142699750_1142699751 -8 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699751 17:1651691-1651713 GTCTGGTGAGTGCCCCACTGCGG 0: 1
1: 0
2: 1
3: 22
4: 167
1142699750_1142699755 11 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699755 17:1651710-1651732 GCGGCACCATCACAATGCAGCGG 0: 1
1: 0
2: 0
3: 5
4: 81
1142699750_1142699757 26 Left 1142699750 17:1651676-1651698 CCAGGCAGGTGCACGGTCTGGTG 0: 1
1: 0
2: 1
3: 15
4: 194
Right 1142699757 17:1651725-1651747 TGCAGCGGATCTCCTTCACCTGG 0: 1
1: 0
2: 1
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142699750 Original CRISPR CACCAGACCGTGCACCTGCC TGG (reversed) Exonic
900114139 1:1021315-1021337 CACCAGGCCCTCCCCCTGCCTGG + Intronic
900418566 1:2546017-2546039 CCCCAGCCCAGGCACCTGCCCGG - Intergenic
900517356 1:3089208-3089230 CACCAGCCCTGGCCCCTGCCTGG + Intronic
900633176 1:3649576-3649598 CACCTGCCCGGGCACCTGCCGGG + Intronic
901243186 1:7706960-7706982 CACCACAACCTGCACCTCCCGGG + Intronic
901431021 1:9215006-9215028 CACCACAACCTCCACCTGCCAGG - Intergenic
902408233 1:16198233-16198255 CACCAGAACGTTCCCCAGCCAGG + Exonic
902681800 1:18048912-18048934 CACCAGACATGGCACCGGCCAGG - Intergenic
904038684 1:27572030-27572052 TGCCAGACCCTGCACCAGCCTGG + Intronic
904714277 1:32455270-32455292 CACCACAGCCTCCACCTGCCTGG - Intergenic
905340879 1:37276512-37276534 CTCCAGACCTTCCTCCTGCCTGG - Intergenic
906531225 1:46525235-46525257 GACCAGGCAGTGCAACTGCCAGG + Intergenic
907210541 1:52817911-52817933 CACCACACCCTCCACCTCCCAGG + Intronic
907390456 1:54154796-54154818 CACCAGACCCTGCACCCAGCAGG - Intronic
909176956 1:72372654-72372676 CACCACAACCTCCACCTGCCGGG - Intergenic
911122790 1:94312718-94312740 CACCACACCCTGGTCCTGCCTGG + Intergenic
911217008 1:95205902-95205924 CACCAGACAGTGAATCTGCCAGG - Intronic
912509553 1:110179627-110179649 CACCACAACGTCCACCTCCCGGG + Intronic
914239130 1:145839903-145839925 CACCAGACCATGCCCCATCCAGG + Exonic
916349476 1:163832870-163832892 CACCAGGCAATGAACCTGCCAGG - Intergenic
919118895 1:193314620-193314642 CACCAGAACCTCCACCTTCCGGG - Intergenic
922475656 1:225905509-225905531 GGCCAGACCTTGCACTTGCCTGG + Intronic
924004646 1:239595011-239595033 CACCATAACCTCCACCTGCCGGG - Intronic
1063123042 10:3118019-3118041 CACCAGACTGTGCCCCTCCCTGG - Intronic
1063320265 10:5045750-5045772 CTGCAGTCCGTGCACCAGCCTGG - Intronic
1064055408 10:12093117-12093139 CACCACAACTTGCACCTCCCGGG + Intronic
1070212284 10:74337358-74337380 CAGAAGACATTGCACCTGCCTGG + Intronic
1070761671 10:79027974-79027996 CACCTGACCTAGCACCTACCAGG + Intergenic
1072259835 10:93659148-93659170 CACCTGACTTTGCACCTCCCAGG - Exonic
1072547391 10:96450070-96450092 CACCAGACCTGGCACATGGCAGG + Intronic
1072665829 10:97391493-97391515 CACCACACCCTCCACCTCCCGGG - Intronic
1074804600 10:117035869-117035891 CACCAGAACCTCCACCTCCCAGG - Intronic
1075102880 10:119518481-119518503 CTCCTGATCGTGCACCTGCAGGG - Intronic
1075738578 10:124679391-124679413 CACAAGGCCGTGCACTCGCCAGG + Intronic
1076516205 10:131045799-131045821 CACTAGAGTCTGCACCTGCCAGG - Intergenic
1076744751 10:132507291-132507313 CACCTGGTCATGCACCTGCCTGG + Intergenic
1077309646 11:1882667-1882689 CCCCACCCCCTGCACCTGCCTGG + Intronic
1077893933 11:6439970-6439992 CACTGGATGGTGCACCTGCCAGG + Intronic
1078062036 11:8054426-8054448 CTCCAGCCCTTGCCCCTGCCAGG - Intronic
1078461307 11:11517111-11517133 CACCAGACACTGAACCTGCTGGG + Intronic
1081534231 11:43985625-43985647 CACCAGACCGTGCCCCTCAAGGG - Intergenic
1082563762 11:54650882-54650904 CACCACAACCTGCACCTCCCAGG + Intergenic
1085318694 11:75561691-75561713 GACCAGACCCGGTACCTGCCCGG - Intergenic
1088510369 11:110567276-110567298 CACCAGATGGTGCTCCAGCCAGG - Intergenic
1090242265 11:125192496-125192518 CCCCAGACCTAGCTCCTGCCAGG - Intronic
1093297713 12:17411502-17411524 TACCAGAACGTGAACCTGACTGG + Intergenic
1096736179 12:53656768-53656790 CACCACACCCTCCACCTCCCAGG - Intronic
1098864194 12:75743515-75743537 CACCAGAACTTCCACCTCCCAGG + Intergenic
1100398758 12:94208772-94208794 CACCAGACGGGGCACCAACCTGG - Intronic
1102303002 12:111784435-111784457 CATCAGCGCTTGCACCTGCCTGG + Intronic
1108125439 13:47237801-47237823 CTCCAGCCTGTGCTCCTGCCTGG - Intergenic
1112102364 13:96203258-96203280 CACCAGACATTGCATCTACCTGG - Intronic
1114188203 14:20419683-20419705 CACCAGACAGGGCACATGTCTGG - Intergenic
1116235175 14:42271144-42271166 CACCGGACCCTCCACCTACCAGG + Intergenic
1117754492 14:58959829-58959851 CACCACAACCTCCACCTGCCAGG + Intergenic
1119240219 14:73053241-73053263 CACCACACCCTCCACCTTCCAGG + Intergenic
1119663371 14:76466797-76466819 CACCACACCCTCCACCTCCCGGG + Intronic
1121533927 14:94678054-94678076 CACCAGACCCTCCACTGGCCTGG + Intergenic
1122509021 14:102250785-102250807 CACCAGGCCAGGCTCCTGCCTGG - Intronic
1122700517 14:103585401-103585423 CACCACAACCTCCACCTGCCAGG - Intronic
1122774122 14:104109738-104109760 CACGAGACCTGTCACCTGCCAGG - Intronic
1122888689 14:104722956-104722978 CACCTGACCGTGCCCCAGCCTGG - Intergenic
1123707325 15:22959710-22959732 CAACAGACCGTGTATCTGCTGGG + Intronic
1124253510 15:28122618-28122640 CACCAGCCCGCCCACCTTCCTGG + Intronic
1125523233 15:40359493-40359515 CACCAGTCCAGGGACCTGCCTGG + Intronic
1127290012 15:57561905-57561927 CACCACAACTTCCACCTGCCAGG + Intergenic
1127875109 15:63105373-63105395 CACCAGGCCATGAACCTCCCAGG - Intergenic
1128229023 15:66022048-66022070 CTCCAGACCCACCACCTGCCTGG - Intronic
1129508993 15:76106189-76106211 CACCATGCCGTGCACGTGGCAGG - Intronic
1129995845 15:80004309-80004331 CAGCAGACCCAGCACATGCCAGG - Intergenic
1130558981 15:84944177-84944199 CACCAGGCAGTGTAGCTGCCAGG - Intronic
1131494588 15:92894851-92894873 CACCACAACCTGCACCTCCCAGG - Intronic
1138519621 16:57563574-57563596 CACCAGCCCCAGCCCCTGCCAGG - Intronic
1139375247 16:66492872-66492894 CACCAGCCCTTGGTCCTGCCTGG + Intronic
1139762716 16:69199517-69199539 CACCAAAGCGTCCACCTCCCAGG - Intronic
1140334815 16:74095404-74095426 CACCAGACATTGAATCTGCCAGG - Intergenic
1141340936 16:83203146-83203168 CACCACAACCTCCACCTGCCAGG - Intronic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1142385407 16:89760783-89760805 CACCAGCCTCTGCTCCTGCCTGG + Intronic
1142699750 17:1651676-1651698 CACCAGACCGTGCACCTGCCTGG - Exonic
1143117049 17:4587048-4587070 AACCAGACCGGGGAACTGCCAGG + Intronic
1143323524 17:6083360-6083382 CACCAGACCGAGCTCCTCCAGGG - Intronic
1144048881 17:11480461-11480483 CACCACACCGGACAGCTGCCAGG + Intronic
1144354281 17:14429266-14429288 AACCAGAGCTTGCACCAGCCTGG + Intergenic
1144728246 17:17512439-17512461 CACCTGGCCCTGCACCTCCCTGG + Intronic
1145800880 17:27683964-27683986 CACCAGACAGTACACCTGGAGGG - Intergenic
1149453422 17:56767814-56767836 CTCCAGACAGAGAACCTGCCAGG + Intergenic
1151349242 17:73521922-73521944 CACGAGGCCTGGCACCTGCCTGG - Intronic
1151495951 17:74458192-74458214 CACCAGACCGTGCATAGGACGGG - Intergenic
1152636387 17:81432257-81432279 CAGGAGACGGTGCACCTGCCGGG - Intronic
1152859754 17:82689317-82689339 CACCAGCCTGTCCACCAGCCTGG - Intronic
1155376155 18:25160062-25160084 CACCAGACAACTCACCTGCCAGG + Intronic
1155380173 18:25212432-25212454 CACCACAACGTCCACCTACCGGG - Intronic
1155436365 18:25816814-25816836 CACCACAACCTCCACCTGCCGGG + Intergenic
1157950875 18:52035532-52035554 CACCAGAACTTGAACCTCCCAGG + Intergenic
1159746867 18:72247267-72247289 CACCAGAGCCTGCATCTCCCTGG - Intergenic
1160586595 18:79916697-79916719 CACGAGACCGAGCTCCTGCCTGG + Intronic
1160814525 19:1028954-1028976 CCCCTGACCTGGCACCTGCCTGG - Intronic
1161798415 19:6401283-6401305 CATGAGACCCTGCACCTGCCTGG + Intergenic
1163321235 19:16576234-16576256 CACCAGCACATGCAGCTGCCTGG + Exonic
1165307878 19:35013347-35013369 CCCCAGACCGTTCAGCTGCAAGG - Exonic
1166683002 19:44779391-44779413 CTCCAGACCCAGGACCTGCCTGG + Intronic
1167166723 19:47803811-47803833 GACCAGACCTTGCACCTCTCTGG + Intronic
1167175114 19:47859953-47859975 GACCAGACCTTGCACCTCTCTGG - Intergenic
1167201148 19:48066428-48066450 CACCATGCCATGCAGCTGCCGGG - Intronic
1167674885 19:50877858-50877880 CTCCAGGCCTTGCCCCTGCCTGG + Intronic
1168001122 19:53446908-53446930 CACCAGACCCAGCATCTGCATGG + Intronic
925030255 2:645026-645048 GTCCAGACCGTGCATCTTCCAGG - Intergenic
925318107 2:2940446-2940468 CCCCAGAGCCTGCCCCTGCCAGG + Intergenic
932239355 2:70144757-70144779 CACCATAACCTCCACCTGCCGGG - Intergenic
933728238 2:85438259-85438281 CCCCAGCCCGTGCCCCTTCCTGG - Intergenic
938548153 2:132353353-132353375 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
946723083 2:222631994-222632016 CACCACAACCTGCACCTCCCGGG - Intronic
947965335 2:234275706-234275728 CCCCAGAGAGAGCACCTGCCAGG + Intergenic
948582941 2:239000267-239000289 CACCAGACACTGCATCTGCCTGG - Intergenic
948788321 2:240364594-240364616 CCCCAGCCCCTGCAGCTGCCAGG - Intergenic
1170857936 20:20074876-20074898 CACCAGACCGTCCAGATGCCAGG + Intronic
1171877024 20:30586125-30586147 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
1173865357 20:46309095-46309117 CACCCGACCTCCCACCTGCCTGG - Intergenic
1174752131 20:53122210-53122232 CACCACATCCTGCACCTGCTGGG - Intronic
1175778816 20:61669331-61669353 CACCAGATGGTGGACCTGCTAGG - Intronic
1177045165 21:16160135-16160157 CAGCAGACAGAGCACCAGCCAGG + Intergenic
1178892241 21:36529965-36529987 CACCTGAGCGGGCACCTGCTGGG + Intronic
1179165475 21:38932192-38932214 CACCACAGCCTGGACCTGCCAGG + Intergenic
1180161110 21:45999108-45999130 CAACAGACCGTGCACCACCCGGG - Intronic
1181541157 22:23574000-23574022 CACCAGGCTGTGCCCCAGCCTGG + Intronic
1183831544 22:40420772-40420794 CACCAGACCTGGCACCTGCCTGG + Intronic
1184668074 22:45998914-45998936 CCCTTGACCGTGCAGCTGCCTGG + Intergenic
1184931249 22:47682733-47682755 CACCAGATGCTGAACCTGCCTGG - Intergenic
1185243160 22:49757163-49757185 CAGCAGCCCGTCCACCTGTCTGG + Intergenic
1185303609 22:50099308-50099330 CACCAGACCCGGAATCTGCCAGG + Intronic
950572696 3:13811797-13811819 CTGCAGTCCCTGCACCTGCCTGG - Intergenic
953383718 3:42492890-42492912 CCCCAGACCCTGAACTTGCCAGG + Intronic
954551051 3:51481913-51481935 CACCACAACCTCCACCTGCCAGG - Intronic
955511658 3:59686999-59687021 CACCACACCCTCCACCTCCCGGG - Intergenic
960222506 3:115130835-115130857 CACCACAACCTGCACCTCCCAGG + Intronic
965559825 3:170050480-170050502 CACCATAACCTCCACCTGCCAGG + Intronic
968737495 4:2304893-2304915 CACCAGCTCCTGCAGCTGCCTGG - Exonic
969683000 4:8653519-8653541 CCCCAGCCTGGGCACCTGCCTGG - Intergenic
970666512 4:18343031-18343053 CACCAAACCGTCCAGCTCCCTGG + Intergenic
974859588 4:67503317-67503339 CAGCAAACCGTGCAGCTGTCTGG - Intronic
981018530 4:140000950-140000972 CACCACAACGTCCACCTCCCAGG - Intronic
985642015 5:1067913-1067935 CACAAGTCCCCGCACCTGCCCGG + Intronic
985688233 5:1293491-1293513 CACGAAGCCGTACACCTGCCAGG + Exonic
986268700 5:6212544-6212566 CACCAGACACTGCATCAGCCAGG + Intergenic
989505466 5:42222104-42222126 CACCAGAACCTCCACCTCCCAGG + Intergenic
989633504 5:43511280-43511302 AACCAGACAGGGCAGCTGCCGGG - Intronic
990732722 5:58827033-58827055 CAGGAGACCGTACACCAGCCAGG - Intronic
992751815 5:79869486-79869508 CACCACACCTTCCACCTCCCAGG + Intergenic
997373821 5:133382963-133382985 GAACAGAGCGTGCAACTGCCTGG + Intronic
997419456 5:133754700-133754722 CCCCAGAGCGTGGACCTGACAGG - Intergenic
997518588 5:134507627-134507649 CACCAGTCCTTACACCTGCCCGG - Intergenic
998330358 5:141320724-141320746 CACCAGACCCCGCACCTCGCCGG + Exonic
999704404 5:154258715-154258737 CATAATACCCTGCACCTGCCTGG - Intronic
1001563695 5:172686313-172686335 CGCCAGCCCCTGCCCCTGCCAGG - Intronic
1001825967 5:174745320-174745342 CACCAGACACTGAACCTGGCCGG - Intergenic
1005691751 6:28313213-28313235 AACCAGACCCAGCACCTGCGTGG - Intergenic
1005968444 6:30743089-30743111 CCCCAGCCCGCGCACCTCCCTGG - Intergenic
1007178723 6:39913414-39913436 CACCACACAGTTCACCTGGCCGG + Exonic
1008130378 6:47714183-47714205 CACCAGACCATTTACCTGTCTGG - Exonic
1009631944 6:66211020-66211042 CACCACAGCCTGCACCTGTCGGG - Intergenic
1014515120 6:122368612-122368634 CACCAGGCACTGAACCTGCCAGG - Intergenic
1014824527 6:126033729-126033751 CAGCAGACCATGCATCTGCCAGG - Intronic
1017869919 6:158478638-158478660 CACCCCACCCTGCAACTGCCTGG + Intronic
1019343565 7:519448-519470 CGCCACACCGATCACCTGCCTGG + Intronic
1019405337 7:880584-880606 AGCCACACCGTGCCCCTGCCAGG - Intronic
1019409353 7:899852-899874 CACGGGACCGTGCACCTGCGCGG - Intronic
1024522347 7:50316523-50316545 CACCACAGCGAGCACCTTCCTGG - Intronic
1025079889 7:55972506-55972528 CACTACACCCTGCACCTCCCGGG + Intronic
1030618966 7:111769054-111769076 CACCAGACACTGTATCTGCCAGG + Intronic
1031313878 7:120232903-120232925 TACCAGAACCTGAACCTGCCTGG - Intergenic
1033225208 7:139556400-139556422 CACCACAACTTGCACCTCCCAGG + Intergenic
1034947560 7:155273133-155273155 GACCAGAACGTGCACCATCCAGG - Intergenic
1035088357 7:156281279-156281301 CATCAGACACTGCACCTGCTGGG - Intergenic
1035201905 7:157273089-157273111 CATCAGACCGCGCCCCTCCCCGG + Intergenic
1035621990 8:1042116-1042138 CCCCAGCCCCAGCACCTGCCTGG + Intergenic
1036149177 8:6282160-6282182 CACCAGGCCTGGCACATGCCAGG - Intergenic
1038105553 8:24429944-24429966 CACCAGACCGTGCACCTTGTTGG - Intergenic
1039528550 8:38238103-38238125 CATCAGACCCTGCAACTGGCTGG - Exonic
1040605554 8:48927868-48927890 CACCAGACTCTGAATCTGCCCGG + Intergenic
1043854117 8:85245431-85245453 CACCAGAGCCTGGAACTGCCAGG - Intronic
1045099993 8:98834581-98834603 CACCAGACACTGAATCTGCCAGG - Intronic
1047409014 8:124609114-124609136 CACCACACAGAGCCCCTGCCAGG + Intronic
1048997505 8:139803464-139803486 CTCCAGACAGTGCAACTGCAGGG + Intronic
1049320260 8:141992451-141992473 CACCAGACCGTGAGCTTCCCAGG + Intergenic
1049385903 8:142342870-142342892 CACCTGTCCCAGCACCTGCCCGG + Intronic
1049385930 8:142342999-142343021 CACCTGTCCCAGCACCTGCCCGG + Intronic
1049550884 8:143258920-143258942 CTCCAGACTGTGCTGCTGCCTGG - Intronic
1049614889 8:143571807-143571829 CACCAGAGCATGCACCTGGTGGG + Exonic
1050939219 9:11438883-11438905 CACCACAACCTGCACCTCCCAGG + Intergenic
1053353791 9:37430224-37430246 CACCAGGCTGTGGACCCGCCAGG - Intronic
1053752732 9:41273335-41273357 CCCCAGACCCTGCCCCCGCCCGG + Intergenic
1054258258 9:62837687-62837709 CGCCAGACCCTGCCCCCGCCCGG + Intergenic
1056701721 9:88916707-88916729 CACCAGCCTGTGCACCTGGGAGG - Intergenic
1058415954 9:104788763-104788785 CCCCAGTCCTTGCACCTCCCTGG + Intronic
1059445630 9:114336319-114336341 CCGCAGACCGTGCCCCAGCCCGG + Exonic
1059454772 9:114392996-114393018 AAACAAACCGTGCACGTGCCAGG + Intronic
1061041363 9:128142676-128142698 CCCCAGCCCCAGCACCTGCCTGG + Intergenic
1061405970 9:130393295-130393317 CTCCATACCCTGCACCTGCAAGG - Intronic
1061948539 9:133922259-133922281 CCCCAGAGCGTCTACCTGCCTGG + Intronic
1061990011 9:134153720-134153742 CACCAGCGCGTGCACGTGCTTGG + Intronic
1062291429 9:135797004-135797026 GCCCAGCCCCTGCACCTGCCCGG + Intergenic
1062389437 9:136328038-136328060 CACCCCACGGTGCCCCTGCCAGG - Intronic
1202800515 9_KI270719v1_random:170688-170710 CGCCAGACCCTGCCCCCGCCCGG - Intergenic
1203364307 Un_KI270442v1:243728-243750 GAGCAGACCTGGCACCTGCCCGG - Intergenic
1185685304 X:1923733-1923755 CACCACAACCTCCACCTGCCGGG - Intergenic
1186827568 X:13356361-13356383 CACCACACCCTCCACCTCCCGGG + Intergenic
1187889159 X:23917491-23917513 CACCACAACCTCCACCTGCCAGG + Intronic
1188609687 X:32080703-32080725 CACCAGCCCTTCCACCTGCTGGG - Intronic
1196918951 X:120566471-120566493 CACCACAACGTCCACCTCCCGGG + Intronic
1200052983 X:153444607-153444629 CTCAGGTCCGTGCACCTGCCAGG - Intergenic