ID: 1142701814

View in Genome Browser
Species Human (GRCh38)
Location 17:1667087-1667109
Sequence TACTTAAACCCGGGAGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242598
Summary {0: 2, 1: 409, 2: 12721, 3: 70978, 4: 158488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142701804_1142701814 9 Left 1142701804 17:1667055-1667077 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1142701814 17:1667087-1667109 TACTTAAACCCGGGAGGCGGGGG 0: 2
1: 409
2: 12721
3: 70978
4: 158488
1142701802_1142701814 17 Left 1142701802 17:1667047-1667069 CCTGTAATCCCAGCTACTCAGGA 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
Right 1142701814 17:1667087-1667109 TACTTAAACCCGGGAGGCGGGGG 0: 2
1: 409
2: 12721
3: 70978
4: 158488
1142701806_1142701814 8 Left 1142701806 17:1667056-1667078 CCAGCTACTCAGGAGGCTGAGGC 0: 84870
1: 190808
2: 228673
3: 158767
4: 94038
Right 1142701814 17:1667087-1667109 TACTTAAACCCGGGAGGCGGGGG 0: 2
1: 409
2: 12721
3: 70978
4: 158488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142701814 Original CRISPR TACTTAAACCCGGGAGGCGG GGG Intronic
Too many off-targets to display for this crispr