ID: 1142702861

View in Genome Browser
Species Human (GRCh38)
Location 17:1674781-1674803
Sequence GCACAACTCCGCCTCGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142702861_1142702865 5 Left 1142702861 17:1674781-1674803 CCACTCCCGAGGCGGAGTTGTGC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142702865 17:1674809-1674831 CACCCAGGCTGAGAGTGCACTGG 0: 1
1: 10
2: 93
3: 286
4: 705
1142702861_1142702864 -10 Left 1142702861 17:1674781-1674803 CCACTCCCGAGGCGGAGTTGTGC 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142702864 17:1674794-1674816 GGAGTTGTGCTCAGTCACCCAGG 0: 1
1: 11
2: 684
3: 14126
4: 51217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142702861 Original CRISPR GCACAACTCCGCCTCGGGAG TGG (reversed) Intronic
901008403 1:6183187-6183209 CCACACCTCCTCCTCGGCAGGGG + Intronic
901539704 1:9908069-9908091 GCAAAACTCCGTCTTGGGCGGGG - Intronic
905390508 1:37633296-37633318 GCACAACCCAGCTTGGGGAGTGG + Intronic
906028925 1:42700981-42701003 GCCCTGCTCAGCCTCGGGAGCGG - Exonic
916701656 1:167302078-167302100 GCAAGACTCCGTCTCGGGGGCGG - Intronic
922932889 1:229403889-229403911 GCACACCTGCCCCTCGGGAAAGG + Intergenic
923760282 1:236836272-236836294 GCAAAACCCTGCCTCAGGAGGGG - Intronic
924610972 1:245573636-245573658 GCAAATTTCTGCCTCGGGAGGGG - Intronic
1063460617 10:6212975-6212997 GCCCCACTCTCCCTCGGGAGAGG + Intronic
1064147860 10:12839778-12839800 GCAAGACTCTGTCTCGGGAGGGG + Intergenic
1075467964 10:122665627-122665649 ACACCACTCCACCTCTGGAGCGG - Intergenic
1079251983 11:18793175-18793197 GCAAGACTCCGTCTCGGGGGCGG - Intergenic
1082797636 11:57389414-57389436 GCTCAACTCTGCCTGGGAAGGGG + Intronic
1088993194 11:114972450-114972472 CCAGAACTCCTCCTAGGGAGAGG - Intergenic
1090397292 11:126427422-126427444 GCACAGCTCCGCCAGGGGTGGGG + Intronic
1090877855 11:130806863-130806885 GCACCACTCTGCCTCGGGGTTGG + Intergenic
1091319165 11:134637653-134637675 GCACAGCTACTCCTCTGGAGTGG + Intergenic
1091761699 12:3091799-3091821 CCACAACTCCGCCTCTGGCCTGG + Intronic
1093175680 12:15911259-15911281 CCGCGACTCCGCCCCGGGAGCGG + Exonic
1100403935 12:94256530-94256552 GCAGAACACCGCCTGGGGAAAGG + Intronic
1107412633 13:40172213-40172235 GCGCAGCTCCCCCTCTGGAGGGG - Intergenic
1110575671 13:77052307-77052329 GCCCAACTCAGCCTCCTGAGTGG + Intronic
1117279311 14:54222164-54222186 ACACAGCTCAGCCTCGGCAGGGG - Intergenic
1117377405 14:55129176-55129198 GCGCCGCCCCGCCTCGGGAGAGG + Exonic
1118359694 14:65045426-65045448 GCACGACTCCATCTCGGGGGCGG - Intronic
1118463747 14:66012839-66012861 GCCCTGCTCAGCCTCGGGAGCGG + Intergenic
1120511430 14:85420725-85420747 TCACAACTTGGCCTGGGGAGTGG + Intergenic
1121939411 14:98055591-98055613 CCACATCTCCGGCTTGGGAGAGG - Intergenic
1122092652 14:99350373-99350395 GCACAACTCAGCCAGAGGAGGGG + Intergenic
1131416836 15:92267188-92267210 GCACCAGTCTGCCTCGGGGGTGG + Intergenic
1132765072 16:1530471-1530493 CCACACCTGGGCCTCGGGAGAGG - Intronic
1132947078 16:2537788-2537810 GCCCGACCCCGCCTGGGGAGGGG - Intergenic
1133271485 16:4612842-4612864 GCACAACTGAGACTTGGGAGTGG + Intronic
1137586539 16:49667182-49667204 GCACAACTGCCCCTTGGGATAGG - Intronic
1138387035 16:56643042-56643064 GCACATCGCCCCCTCAGGAGTGG + Intronic
1141185186 16:81781882-81781904 GCAAGACTCCGTCTCGGGGGCGG - Intronic
1142702861 17:1674781-1674803 GCACAACTCCGCCTCGGGAGTGG - Intronic
1142840666 17:2626564-2626586 ACAAGACTCCGCCTCGGGGGGGG - Intronic
1161152363 19:2716492-2716514 GCACAACTGCCCCGCTGGAGAGG - Exonic
1162326376 19:10002174-10002196 GCTGAACTCTGCCTTGGGAGAGG - Intronic
1167975982 19:53226256-53226278 GCAAAACTCCGTCTCGGGGGGGG + Intergenic
932356565 2:71072630-71072652 GCACAACTCCACCTGGGGAAAGG - Exonic
937450622 2:121999542-121999564 GCATAACACCGCCTGGGGTGTGG + Intergenic
942668159 2:178344314-178344336 GCACAACTCGGCGCCGGCAGAGG + Exonic
944770070 2:202905156-202905178 GCAGGACTCCGTCTTGGGAGGGG - Intronic
948897223 2:240933117-240933139 GCACAGCTCCTGCTCGGGTGGGG - Intronic
1175072216 20:56344170-56344192 GCAGAGCTCGGCCTCGGAAGCGG - Intergenic
1181939541 22:26464585-26464607 GCACAACTCTGCCAGGGGTGAGG - Exonic
1183440814 22:37822296-37822318 GCCCAACTCCGGCTCAGCAGAGG + Intergenic
1183576823 22:38696042-38696064 GCAAGACTCCGTCTCGGGTGGGG + Intronic
950664280 3:14485862-14485884 TCACAACTCAGCCTCGCAAGAGG + Exonic
957600367 3:82326261-82326283 ACACACCTCTGCCTGGGGAGTGG + Intergenic
962436732 3:135373900-135373922 GCACAACTCCCTGTGGGGAGAGG - Intergenic
967031788 3:185614609-185614631 GCCCGACTCCGCCTGGGCAGTGG + Exonic
969601544 4:8179436-8179458 ACACAGCTCAGCCCCGGGAGGGG + Intergenic
989051166 5:37321702-37321724 GCAAGACTCTGCCTCGGCAGGGG + Intronic
990149483 5:52800326-52800348 CCTCACCTCCGCCCCGGGAGAGG - Exonic
1012875412 6:104720637-104720659 GCAAAACTCCGTCTGGGGGGGGG - Intergenic
1018937191 6:168281223-168281245 ACACAGCTCCGGCTCGGCAGGGG - Intergenic
1020785923 7:12571876-12571898 GCACAAGACCTCCTGGGGAGAGG - Intronic
1022354077 7:29595162-29595184 GCAAAACTCCGTCTCGGGGGAGG + Intergenic
1028776903 7:94687893-94687915 GCACAACTAAGCCTTGGGAGTGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG + Intronic
1045068925 8:98479472-98479494 GCAACACTCCGTCTCGGGGGGGG + Intronic
1045312683 8:101016888-101016910 GCACAATTCCGCCTCCTGAGTGG - Intergenic
1049066566 8:140321118-140321140 GCACCACTTCACCCCGGGAGTGG + Intronic
1053226441 9:36362344-36362366 GCAAAACTCCGTCTCGGGGGAGG + Intronic
1057115364 9:92516074-92516096 GCAAGACTCCGTCTCGGGGGGGG - Intronic
1057866152 9:98683104-98683126 GCAAGACTCCGTCTCGGGGGAGG - Intronic
1061486851 9:130924484-130924506 GCCCACCTCTGCCTCAGGAGAGG - Intronic
1186282891 X:8013323-8013345 GCAAAACTCCATCTCGGAAGAGG - Intergenic
1194347870 X:92787891-92787913 GCAAAACTCCGTCTCGGGGGAGG - Intergenic
1200656198 Y:5904522-5904544 GCAAAACTCCGTCTCGGGGGAGG - Intergenic