ID: 1142707864

View in Genome Browser
Species Human (GRCh38)
Location 17:1708022-1708044
Sequence CAGCGGGACCAGGCGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142707854_1142707864 -5 Left 1142707854 17:1708004-1708026 CCACAGACTCATCCACCCCAGCG 0: 1
1: 0
2: 2
3: 37
4: 239
Right 1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 169
1142707852_1142707864 17 Left 1142707852 17:1707982-1708004 CCTGGTGGTGCTGCCGGAACAGC 0: 1
1: 0
2: 0
3: 15
4: 145
Right 1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 169
1142707853_1142707864 4 Left 1142707853 17:1707995-1708017 CCGGAACAGCCACAGACTCATCC 0: 1
1: 0
2: 0
3: 12
4: 220
Right 1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142707864 Original CRISPR CAGCGGGACCAGGCGGAAGA GGG Exonic
900613556 1:3554367-3554389 CAGCCGGGCCAGGCGGGAGGGGG + Intronic
900642775 1:3695309-3695331 CAGCGGCCCCAGGAGGAAGTGGG - Intronic
900778160 1:4600081-4600103 CCGCAGGACCAGCCGGGAGAAGG + Intergenic
900917750 1:5650533-5650555 TAGCGGGGCCTGGGGGAAGATGG + Intergenic
902907164 1:19566815-19566837 CAGGGGGACAAGGAGGAAGCTGG + Intergenic
905111135 1:35595403-35595425 CAGCTGGACCAGGAGGGAGAGGG + Intergenic
906391846 1:45424289-45424311 CAGAGAGGCCAGGCAGAAGAGGG + Intronic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
914942206 1:152033142-152033164 CAGCGGGTTCAGGTGGAAAAAGG + Intronic
915969358 1:160343006-160343028 CAGACGGACCCGGAGGAAGACGG - Intronic
917542514 1:175928287-175928309 CAGCTGGACCAGGGAGAATAGGG - Intergenic
921286932 1:213617271-213617293 CAGTGGGACCTGGCAGAATATGG - Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
922765994 1:228157070-228157092 CAGCGGGACCAGCCGGGGGCTGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
1063456376 10:6185525-6185547 CAGCAGCACCCGGTGGAAGAGGG - Intronic
1067142317 10:43667902-43667924 CAGCGGGACCTGCCGTAGGAGGG - Intergenic
1067769856 10:49115401-49115423 CGGCGGGGCCAGGCGGGAGCGGG - Intronic
1070590567 10:77797743-77797765 CACAGGGACCAGGAGGCAGAAGG + Intronic
1072188201 10:93061504-93061526 CAGTGGGAGCCGGGGGAAGAAGG - Intronic
1075808944 10:125210335-125210357 GAGCTGGACCTGGGGGAAGAGGG + Intergenic
1076908063 10:133373096-133373118 GTGCGGGGTCAGGCGGAAGAGGG + Intronic
1078072050 11:8120512-8120534 CACCGGGACCTGTCGGAGGATGG + Intronic
1078697020 11:13644576-13644598 TAGCTGGAGCAGGAGGAAGAGGG + Intergenic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079055994 11:17207490-17207512 CCGCGGGACAAGGCGGGGGAGGG + Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1086530035 11:87774160-87774182 CAGCAGGACAAGGCAGAAGGTGG + Intergenic
1089737949 11:120562908-120562930 CAGCTGGACCCTGCAGAAGAGGG - Intronic
1091699732 12:2651671-2651693 GACCCGGAACAGGCGGAAGAAGG - Exonic
1094337146 12:29372409-29372431 AAGCGGGAAAAGGCGGGAGAAGG + Intronic
1095985289 12:47995272-47995294 CAGGGGGACCAGGAGGACCACGG + Exonic
1096003546 12:48149651-48149673 CAGAGCCACCAGGCGGGAGATGG + Exonic
1096828984 12:54300241-54300263 CAGCTGGACCTGGAGGGAGAAGG - Intronic
1102461665 12:113103865-113103887 CAGCCAGCCCAGGCGGAAGTGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103399111 12:120630628-120630650 CACAGGGACCAGGCTGAAGGAGG - Intergenic
1103570108 12:121839388-121839410 CAGCGGGACCACGCGGAGAGGGG - Intergenic
1103901230 12:124304487-124304509 GAGCGGGACCGGGCGGAAAGGGG + Intronic
1104155355 12:126126110-126126132 CTGCTGGACCAGGCGGCACAGGG + Intergenic
1104615324 12:130263344-130263366 CAGCGTGACCAGGAAGAACAGGG + Intergenic
1104920231 12:132286618-132286640 GGGCGGTGCCAGGCGGAAGAGGG + Intronic
1105256154 13:18745077-18745099 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1111406259 13:87810968-87810990 CAGCGGGAGGAGGCGGAGGTTGG - Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1115017406 14:28633831-28633853 CAGCTGGACCAGGGGAAAGTGGG - Intergenic
1117097743 14:52314898-52314920 CATCGTGGCCAGGCTGAAGAAGG - Exonic
1118186422 14:63542718-63542740 CAGGAGGACCGGGAGGAAGAAGG + Intronic
1121104044 14:91269405-91269427 CAGCGGGACCAGTCGGCGGGAGG + Intergenic
1121426664 14:93857044-93857066 CAGCTGGACCGTGCGGCAGATGG + Intergenic
1122015336 14:98790269-98790291 CAGTGGGACCAGGTGGGAGCAGG - Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1129850532 15:78791152-78791174 CAGCAGGACCAGGCGCACAATGG + Exonic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1131395790 15:92084911-92084933 CCGCAGGGCCAGGCGGAAGGAGG + Intronic
1131819478 15:96257679-96257701 CAGGGGGAACAGGCAGAAAAGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132567733 16:630988-631010 CAGAGGGGCCAGGCTGAAGCTGG + Exonic
1133747201 16:8696279-8696301 CAGGGGGACCCTGGGGAAGAAGG + Intronic
1137683805 16:50372374-50372396 CAGAGAGGCCAGGCTGAAGAGGG - Intergenic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1138672834 16:58629557-58629579 AAGTGGGACGAGGCGGGAGAGGG - Intronic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1140442618 16:74999255-74999277 CCGCGGGAGGAGGCGGAGGAGGG - Exonic
1142687470 17:1586014-1586036 CAGCTGGAGCACGCCGAAGATGG + Exonic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143290303 17:5823148-5823170 CAGCCTGACCAGGCTGAAGCAGG - Intronic
1144078444 17:11740065-11740087 CACAGGGACCTGGCTGAAGAAGG - Intronic
1146355124 17:32127294-32127316 CAGCAGGACCAGGCAGCACAGGG - Intergenic
1147412050 17:40260606-40260628 CAAAGGGACCAAGCTGAAGAAGG + Exonic
1147976954 17:44253308-44253330 CAGCAGGTCCAGGTGGAAGCCGG + Exonic
1153448157 18:5196806-5196828 CAGCGGGACGAGGGCGAGGAAGG + Intronic
1154485919 18:14871190-14871212 CAGCAGGACCAGGCAGGTGAGGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155618001 18:27743679-27743701 CAGCGTGACGACGCAGAAGACGG - Intergenic
1155877188 18:31101912-31101934 CAGCAGGAGCAGCCGGCAGAGGG + Exonic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1157222964 18:45840299-45840321 CAGGGGGTCCAGGCAGGAGAAGG + Intronic
1158839194 18:61365308-61365330 CAGTGGGACCCGACAGAAGATGG - Intronic
1159955499 18:74515851-74515873 CAGAGGCACCAGGAGTAAGAGGG - Intronic
1160422738 18:78758725-78758747 CACCGTGACCAGGAGGAAAAGGG + Intergenic
1160579623 18:79876158-79876180 CAGCGGCACCAGGCGGGAGATGG - Intronic
1160809862 19:1008712-1008734 CGGCAGCGCCAGGCGGAAGAAGG - Exonic
1161359400 19:3838823-3838845 CATCGGGACCAGGGAGGAGACGG - Intronic
1161994395 19:7703624-7703646 CACCTGGTCCAGGGGGAAGAGGG - Intergenic
1163678576 19:18667915-18667937 CAGCGAGGCCAGGCTGAAGGTGG - Exonic
1164426371 19:28145558-28145580 CAGCGGCAGCAGGTGGCAGAGGG - Intergenic
1166293350 19:41877345-41877367 CAGCAGGAAGAGGAGGAAGATGG - Exonic
1167303883 19:48696068-48696090 CAGCAGGACCAGGTGAGAGAAGG + Exonic
925685599 2:6469706-6469728 CAGCTGCACCAGGCTAAAGAGGG + Intergenic
926298984 2:11588908-11588930 CAGCTGGACCAGGTAGTAGACGG - Exonic
926819910 2:16840647-16840669 CAGCAGTACCTGGGGGAAGAAGG - Intergenic
927949608 2:27158807-27158829 GAGGGAGAGCAGGCGGAAGAGGG + Intergenic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931216944 2:60254179-60254201 CAGGGGGACCAGCCAGAAGTTGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
934640160 2:96023116-96023138 CAGCTGGCCCTGGCGGAGGAAGG + Exonic
934793485 2:97082284-97082306 CAGCTGGCCCTGGCGGAGGAAGG - Intergenic
935753664 2:106260857-106260879 GAGCAGGCCCAGGTGGAAGAAGG + Intergenic
939475884 2:142686124-142686146 TGGCTGGAGCAGGCGGAAGAGGG - Intergenic
944226587 2:197354835-197354857 GAGCTGGACCAAGTGGAAGATGG - Intergenic
944402289 2:199341931-199341953 CTGCAGGACCAGGCTGAAGCTGG - Intronic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
946037682 2:216756702-216756724 CAGGGGGAGCTGCCGGAAGAAGG + Intergenic
948225189 2:236304367-236304389 CAGCAGGACCTGGAGGAAGCTGG - Intergenic
948803205 2:240442070-240442092 CAGCAGGAGCTGGCGGGAGATGG - Intronic
948818124 2:240523901-240523923 CAAAGGGACCATGCGGAGGATGG - Exonic
1173454928 20:43194291-43194313 CTGAGGGACCAGGCAGCAGATGG - Intergenic
1173460712 20:43241080-43241102 CAATGGGACCAGGCTGAAGCTGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174656693 20:52177611-52177633 CACCGAGAACAGGAGGAAGACGG + Intronic
1175372111 20:58499157-58499179 CAGCTGGACCATGCCGATGAAGG - Intronic
1176795385 21:13368188-13368210 CAGCAGGACCAGGCAGGTGAGGG + Intergenic
1176842157 21:13850101-13850123 AAGCGGGACCTGGGAGAAGAGGG + Intergenic
1177970591 21:27784721-27784743 GAGCTGGAGCAGGAGGAAGAGGG + Intergenic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1184212502 22:43044120-43044142 CAGCGGGGACAGGGAGAAGATGG - Intronic
950020896 3:9787055-9787077 CAGCATGAACAGCCGGAAGATGG - Exonic
950158535 3:10742214-10742236 CAGCGGGAGGAGGAGGAGGAAGG - Intergenic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
960440041 3:117675515-117675537 CAGGGGCACCATGCAGAAGAGGG + Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
967897226 3:194407532-194407554 CAGCGGGGCCAGGGAGGAGAGGG - Intronic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
973394025 4:49578653-49578675 AAGCGGGACCTGGGAGAAGAGGG - Intergenic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
981504384 4:145482735-145482757 CAGCGGGTGTAGGCGGAAGAGGG - Intronic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
985478353 5:92174-92196 CAGCGGGACCAGGCAGAGTTCGG + Intergenic
985626246 5:990059-990081 CAGGGGGCCCAGGCCAAAGAGGG - Intergenic
985628349 5:1001763-1001785 CCGCGGGACCAGGCCACAGAGGG + Intergenic
986263237 5:6167358-6167380 CAGCAGGACTGGGCAGAAGAGGG - Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
998364354 5:141619090-141619112 CTGCGGGTCCGGGCGGAAGTGGG - Intergenic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002473433 5:179451051-179451073 CCGGGGAACCTGGCGGAAGAGGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1007902332 6:45423156-45423178 CAGCGGGCACAGGTGGGAGAGGG - Intronic
1007978869 6:46130090-46130112 AAGGGGGACCTGGAGGAAGAGGG - Exonic
1011640409 6:89412104-89412126 CAGCGGGGCCCGGCGGAAGCGGG + Exonic
1014078576 6:117264777-117264799 CACCGGGAGCAGCCGGAAGCGGG + Intergenic
1016384194 6:143515071-143515093 CAGGGTGCCCAGGCGGGAGATGG + Intergenic
1018867864 6:167759564-167759586 CAGCCTGACCAGGCGGGAGATGG + Intergenic
1018903293 6:168061803-168061825 CAGCGGGAGGAGGCAGAAGGTGG - Exonic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1022089150 7:27096480-27096502 CAGCGCGCCCAGCCGGAAGGCGG + Intergenic
1022092646 7:27117657-27117679 CAGCCGGAGCAGCTGGAAGAGGG - Intronic
1022549104 7:31220169-31220191 CAGGGTGACCAGTTGGAAGAAGG - Intergenic
1026727273 7:72879578-72879600 CAGAGGGGCCAGGCGGGAGGTGG + Exonic
1026829559 7:73602685-73602707 AAGGGGGACCAGGTGGGAGATGG + Intronic
1034274638 7:149818663-149818685 CAGGGGGACCAGGAGGACCATGG - Intergenic
1034438550 7:151075296-151075318 CAGCAGGTCCAGGTGGAAGCCGG - Exonic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1038196089 8:25369577-25369599 AAGCTGGACCAGGAGGTAGAAGG + Exonic
1039088763 8:33806028-33806050 GAGTGGGACAAGGAGGAAGAGGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040912326 8:52531645-52531667 CATAGGGACCAGACAGAAGAGGG + Intergenic
1043180751 8:77083689-77083711 CAGCAGGACCAGCAGGAAGTGGG - Intergenic
1046645766 8:116783795-116783817 CAGCATGAGCAGGCAGAAGAGGG - Intronic
1049191063 8:141287872-141287894 CAGGGGCACCTGGAGGAAGACGG + Intronic
1049963174 9:755745-755767 CAGTGGGAACAGGCTGGAGATGG - Intergenic
1051780509 9:20684154-20684176 CAGCCGGAGGAGGCGGAACAGGG + Intronic
1052832693 9:33228924-33228946 CAGGGGGTCCAGGCAGAAGGTGG - Intronic
1052880610 9:33599162-33599184 AAGCGGGACCCGGGAGAAGAGGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1061383527 9:130275051-130275073 CCGTGGGTCCAGGCGCAAGATGG - Intergenic
1061587706 9:131579345-131579367 CAGCGGGGCCGGGCGGGAGCTGG - Exonic
1062030646 9:134360446-134360468 CGGCGGGACCAGGGGAAGGATGG - Intronic
1062057135 9:134474580-134474602 CAGCGGAACCCGGAGGCAGAGGG + Intergenic
1062722635 9:138052402-138052424 CAGCAGGACCAGGCGGCACAGGG + Intronic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1186931131 X:14391876-14391898 CAGCGTGACGATGCAGAAGACGG + Intergenic
1189656344 X:43248786-43248808 CGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1195357287 X:104050904-104050926 CAGCGGGTGCAGGAGGAAAAAGG + Intergenic
1199490855 X:148399024-148399046 CAGTGGGACCAGTAGGTAGAAGG - Intergenic