ID: 1142709548

View in Genome Browser
Species Human (GRCh38)
Location 17:1715803-1715825
Sequence CCCTCCCCAGGCTAGATGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142709541_1142709548 -1 Left 1142709541 17:1715781-1715803 CCGCCCGCTCGGGGGGTCCAGAC No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data
1142709537_1142709548 7 Left 1142709537 17:1715773-1715795 CCTCCTCGCCGCCCGCTCGGGGG No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data
1142709543_1142709548 -5 Left 1142709543 17:1715785-1715807 CCGCTCGGGGGGTCCAGACCCTC No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data
1142709533_1142709548 24 Left 1142709533 17:1715756-1715778 CCGGCAGAGGCAAAGCACCTCCT No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data
1142709542_1142709548 -4 Left 1142709542 17:1715784-1715806 CCCGCTCGGGGGGTCCAGACCCT No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data
1142709540_1142709548 4 Left 1142709540 17:1715776-1715798 CCTCGCCGCCCGCTCGGGGGGTC No data
Right 1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142709548 Original CRISPR CCCTCCCCAGGCTAGATGGC CGG Intergenic
No off target data available for this crispr