ID: 1142711232

View in Genome Browser
Species Human (GRCh38)
Location 17:1724990-1725012
Sequence GCTCTCAGAACCCCGGCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142711214_1142711232 25 Left 1142711214 17:1724942-1724964 CCGGGCGGCCTGGAGGAGATGGC 0: 1
1: 0
2: 1
3: 19
4: 263
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711217_1142711232 17 Left 1142711217 17:1724950-1724972 CCTGGAGGAGATGGCCCAGGGCA 0: 1
1: 0
2: 8
3: 46
4: 400
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711226_1142711232 2 Left 1142711226 17:1724965-1724987 CCAGGGCAGCGGGGGGCGGGAAG 0: 1
1: 0
2: 2
3: 76
4: 484
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711210_1142711232 28 Left 1142711210 17:1724939-1724961 CCCCCGGGCGGCCTGGAGGAGAT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711211_1142711232 27 Left 1142711211 17:1724940-1724962 CCCCGGGCGGCCTGGAGGAGATG 0: 1
1: 0
2: 0
3: 22
4: 176
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711212_1142711232 26 Left 1142711212 17:1724941-1724963 CCCGGGCGGCCTGGAGGAGATGG 0: 1
1: 0
2: 4
3: 43
4: 371
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104
1142711225_1142711232 3 Left 1142711225 17:1724964-1724986 CCCAGGGCAGCGGGGGGCGGGAA 0: 1
1: 0
2: 3
3: 20
4: 338
Right 1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142711232 Original CRISPR GCTCTCAGAACCCCGGCCGG GGG Exonic
901459496 1:9383206-9383228 GCTTCCAGGACCCCGGCCTGGGG + Intergenic
901636905 1:10674764-10674786 GCTCTCAGATCCCCAGGCAGAGG - Intronic
904618977 1:31764215-31764237 GCTCTCAGAGCCCGGGGCTGCGG - Intronic
911497013 1:98644180-98644202 GCTCTCTGAACCCCAGCCTTTGG + Intergenic
915524621 1:156468120-156468142 GGTCTCAGCAGCCCAGCCGGGGG - Exonic
923292344 1:232558410-232558432 GCCATCAGAACCGTGGCCGGGGG - Intronic
1067450935 10:46381451-46381473 GGTGTCAGAGCCCGGGCCGGGGG + Intronic
1067570952 10:47370417-47370439 GCTCTCAGAATACAGGCTGGTGG - Intronic
1067586309 10:47478300-47478322 GGTGTCAGAGCCCGGGCCGGGGG - Intronic
1067658622 10:48216917-48216939 GCCCTCAGTACCCAGGCCTGGGG - Intronic
1075879605 10:125839414-125839436 GATCACAGAACCCCAGCAGGTGG - Intronic
1077164462 11:1128901-1128923 GCTCTCAGGACACCAGCTGGGGG + Intergenic
1077167737 11:1151406-1151428 GCTGTCAGAGGCCCGGCCAGGGG + Intergenic
1077498019 11:2896109-2896131 TCTCTCAGGACCCCGTTCGGAGG + Intronic
1078666911 11:13333429-13333451 GCTCTCAGAACCACATCTGGTGG - Intronic
1082094474 11:48117587-48117609 GCTCTCAAAACCCAGGCTGGAGG - Intronic
1088814919 11:113414299-113414321 GGTCTCAGAACCATGGCCAGTGG + Intronic
1094338912 12:29389346-29389368 GCCCTCCGGACCCGGGCCGGCGG + Intergenic
1095976933 12:47946448-47946470 GCTCTCAGAAGCCAGGACAGAGG + Intergenic
1100477582 12:94948657-94948679 GCTCTGAGAACACAGGCCAGGGG + Intronic
1101441092 12:104704741-104704763 GGCCTCAGAACCCCGGCCTTTGG + Intronic
1101892897 12:108731811-108731833 GCTCTAAGAACCCCGCTCCGGGG - Intergenic
1110846396 13:80194823-80194845 GTTTCCAGAACCCCGGCCTGGGG + Intergenic
1113486188 13:110654011-110654033 TCTCCCAGAGCCCAGGCCGGAGG + Intronic
1113610235 13:111639499-111639521 GCCCTCAGAGCCCAGGCCTGTGG + Intronic
1119294498 14:73522129-73522151 GCTCTCAGAGAGCAGGCCGGTGG + Intronic
1122633041 14:103116391-103116413 GCTCCCAGAACCTGGGCTGGAGG + Intergenic
1129740662 15:77988083-77988105 GCTCTCGGAACACAGGCCGTGGG - Intronic
1129845082 15:78764474-78764496 GCTCTCAGAACACAGGCCGTGGG + Intronic
1130256755 15:82329387-82329409 GCTCTCGGAACACAGGCCGTGGG - Intergenic
1130598194 15:85260601-85260623 GCTCTCGGAACACAGGCCGTGGG + Intergenic
1132519560 16:381178-381200 CCTCCCAGAAGCCGGGCCGGCGG + Intronic
1132550645 16:552613-552635 GCTCTCGGGACCCCTGCCGAGGG - Exonic
1135422395 16:22313978-22314000 ACTCCCAGCACCCCGGCCTGAGG + Intronic
1141700569 16:85640249-85640271 GCTCCCTTAACACCGGCCGGGGG + Intronic
1142613773 17:1123689-1123711 GGGCTCAGAGCCCCGCCCGGGGG - Intronic
1142711232 17:1724990-1725012 GCTCTCAGAACCCCGGCCGGGGG + Exonic
1142752770 17:1998438-1998460 GTGCGCAGATCCCCGGCCGGCGG - Intronic
1148109474 17:45136579-45136601 GGTCCCAGAACCCGGGCCGGGGG - Exonic
1148566161 17:48634131-48634153 GCTCTCCCAACCACGCCCGGTGG + Intergenic
1148578735 17:48728652-48728674 GCTCTCCCCACCCAGGCCGGGGG + Exonic
1149659725 17:58327934-58327956 GGCCCCAGAACCCGGGCCGGGGG + Exonic
1152466784 17:80471093-80471115 GCACTCAGATCCCCGGCCTAGGG - Intronic
1152870882 17:82752409-82752431 GCGCGCCGAACCCGGGCCGGGGG - Intronic
1157553744 18:48599049-48599071 GCTCTCAGGCCCCCGTCGGGTGG - Intronic
1159945861 18:74444451-74444473 GATCTCAGAGTCCCGGCGGGTGG - Intronic
1160211054 18:76880223-76880245 GCTCTCAGAGCCGGCGCCGGTGG + Exonic
1161031860 19:2061342-2061364 GCGCCCAGAGCCCCGGCCGCCGG - Intergenic
1162809176 19:13153984-13154006 CCTCTCAGCAGCCCGGGCGGCGG - Exonic
1163804366 19:19386753-19386775 TCTCTGAGGACCCCTGCCGGAGG + Intronic
1163832618 19:19554324-19554346 GGTCTCAGGACACCGGCTGGCGG + Intergenic
1165941052 19:39415013-39415035 GCTCCCAGAACCTCGGGGGGAGG - Exonic
1166076128 19:40414783-40414805 GCTCTCTGAACCCAGGCCCCAGG + Intergenic
1166544738 19:43627238-43627260 GCTCTCAGATGCCCGCCTGGAGG - Exonic
1168173811 19:54608449-54608471 CCTCTCAGAGCCCAGGCCTGGGG + Intronic
926231259 2:11005801-11005823 GCCATCAGTACCCCGGCTGGAGG + Intergenic
927759820 2:25742926-25742948 GCTCTCTGAGCCCCGGCCGTAGG + Exonic
930029971 2:47052384-47052406 GCTTTCAGAACCCAGGTCTGTGG - Intronic
932824559 2:74927553-74927575 GATCTCAGAAACCCTGCCAGTGG + Intergenic
938518262 2:132038148-132038170 GCCCTCAGAACCGCGGCGGCGGG + Intergenic
947229598 2:227871661-227871683 GCTCTCTTATCCCCGGCCGATGG - Exonic
949039877 2:241843373-241843395 GCTCTCACAGCCCTGGCCAGTGG + Intergenic
1171790050 20:29514909-29514931 CCTCGCAGAACCCCTGCCTGGGG - Intergenic
1172095141 20:32456842-32456864 GCTCTCAGAGCCCCTGCCCACGG + Intronic
1172162915 20:32880781-32880803 GCTCTCAGAACCCAGTCCTCTGG + Intronic
1175051541 20:56160050-56160072 GCTCTGAGAAGCCTGGCTGGAGG - Intergenic
1175297050 20:57915623-57915645 GGTCTCAGAACCACTGCCAGCGG + Intergenic
1175448485 20:59042807-59042829 GCCCCCAGCACCCCAGCCGGCGG + Exonic
1175945165 20:62555281-62555303 GCTCTCAGGCCCCCGACAGGTGG - Intronic
1178639243 21:34332935-34332957 CCTCTCAGAAGCCAGGCCTGGGG + Intergenic
1179971990 21:44841151-44841173 GCTCTCAGAAGCCCTGCACGTGG - Intergenic
1179992894 21:44957791-44957813 CCTCACAGAACCCCAGCCAGTGG - Intronic
1180001195 21:44996270-44996292 GCACTCAGACCCACGGCCAGCGG - Intergenic
1182639359 22:31754119-31754141 GCCCTCAGTGCCCCGGCCAGAGG + Intronic
1184836719 22:47028346-47028368 ACTCTCAGAACCTGGGCCGTGGG - Intronic
1184836734 22:47028403-47028425 GCTCTCAGAACCTGGGCCGTGGG - Intronic
1184836749 22:47028460-47028482 GCTCTCAGAACCTGGGCCGTGGG - Intronic
1184836764 22:47028517-47028539 ACTCTCAGAACCTGGGCCGTGGG - Intronic
950171673 3:10843165-10843187 GCTCTCAGAACCCACGCTTGGGG - Intronic
953149398 3:40310168-40310190 CCTCTCGGAGCCCCGGCCGCGGG + Intronic
954791359 3:53135747-53135769 GCTCTCAGAAGCACTGCCTGAGG + Intergenic
968596758 4:1489834-1489856 ACTCTCAGAACCCCGGGGTGGGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
988567591 5:32331725-32331747 GCTCTCAGAACCCGTTCCAGAGG - Intergenic
989582037 5:43042268-43042290 TCTCTCAGATCCGCGGCCTGAGG + Intronic
998266097 5:140668942-140668964 GCTCTCAGAACCTCAGTCTGGGG + Exonic
1003194297 6:3901503-3901525 GCTGTCAGAACCATGGCTGGAGG - Intergenic
1006767878 6:36524882-36524904 GCTTGCAGAACCCAGGACGGTGG - Intronic
1007424780 6:41739904-41739926 ACCCTCAGAACACCAGCCGGAGG + Exonic
1007618379 6:43196193-43196215 GCTCTCAGAGCCCGGGCGTGTGG - Exonic
1007693633 6:43718257-43718279 GCGCCCAGAACCCAGGCCCGGGG - Intergenic
1016850521 6:148614164-148614186 GCTTTCAGAACTCCTGCCAGTGG - Intergenic
1019732851 7:2637248-2637270 CCGCTCTGACCCCCGGCCGGGGG + Intronic
1020141872 7:5616140-5616162 GTTCTCAGGACCCCTGCGGGGGG - Intergenic
1020892529 7:13897134-13897156 GCTCTCAAAACCCGGGGTGGGGG + Intronic
1022871932 7:34488984-34489006 TCTCTCAGGACCCCTGCCGCTGG - Intergenic
1024137773 7:46428791-46428813 GGTCTCAGAATCACGGCAGGAGG + Intergenic
1029201673 7:98843391-98843413 ACTCTCAGAAGCCAGGCCAGTGG + Intergenic
1029548247 7:101222607-101222629 GCTCCCAGGACCCCGGGCAGCGG + Exonic
1033328348 7:140398093-140398115 TCTCCCAGACCCACGGCCGGAGG + Intronic
1034678762 7:152911898-152911920 GCTCTCAGGGCCCTGGCAGGAGG + Intergenic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1040731943 8:50457910-50457932 GCTCTCAGAACACTGGCAGCCGG + Intronic
1042269574 8:66941612-66941634 GCTCTCATCACCCAGGCTGGAGG + Intergenic
1049145877 8:141000942-141000964 CCTCCCAGAACCCGGGCCGGGGG + Intronic
1049423828 8:142528480-142528502 GCTCTCGGAAACCAGGCAGGAGG - Intronic
1049812506 8:144581795-144581817 GCTCTCAGACCCCCGATGGGGGG + Intronic
1050043443 9:1519571-1519593 CCTCTCAGATCTCCTGCCGGAGG - Intergenic
1053293676 9:36898687-36898709 GCTCTCCGAACACCAGCAGGAGG + Intronic
1058774162 9:108267505-108267527 GGTCTCAGAATCCTGGCGGGAGG - Intergenic
1061130581 9:128705741-128705763 GGCCTCAGGACCCCGGCCGTGGG + Exonic
1061579989 9:131530834-131530856 GCTCCGAGGAGCCCGGCCGGCGG + Intronic