ID: 1142713602

View in Genome Browser
Species Human (GRCh38)
Location 17:1736400-1736422
Sequence CAGGGGTCTCAGCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 517}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142713593_1142713602 10 Left 1142713593 17:1736367-1736389 CCTCTCGGTCCACCTTGGGAGCC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 517
1142713594_1142713602 1 Left 1142713594 17:1736376-1736398 CCACCTTGGGAGCCAGTTGCACT 0: 1
1: 0
2: 1
3: 12
4: 118
Right 1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 517
1142713592_1142713602 11 Left 1142713592 17:1736366-1736388 CCCTCTCGGTCCACCTTGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 104
Right 1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 517
1142713595_1142713602 -2 Left 1142713595 17:1736379-1736401 CCTTGGGAGCCAGTTGCACTGCA 0: 1
1: 0
2: 1
3: 12
4: 150
Right 1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142713602 Original CRISPR CAGGGGTCTCAGCAGGAGGC AGG Intronic
900101251 1:963029-963051 CAGGGGCCTCTCCAGGAGCCTGG + Intronic
900112528 1:1014573-1014595 CAGGGGTCTGAGGCGGACGCTGG - Intergenic
900155858 1:1203033-1203055 CAGGCGTCTCAGCAGCACCCTGG - Intergenic
900423144 1:2564386-2564408 CTGGGGGCTCTGCTGGAGGCAGG - Intronic
900496890 1:2979784-2979806 CAGAGGTGGAAGCAGGAGGCTGG - Intergenic
900592362 1:3465719-3465741 TGGGGGCCCCAGCAGGAGGCCGG - Intronic
900796445 1:4711442-4711464 CTGGGGTCCCAGGTGGAGGCCGG + Intronic
900946775 1:5835219-5835241 CAGGGGTTTCTGCAGGTGACAGG + Intergenic
901028138 1:6290070-6290092 CAGGAGTGTCAGCACGAGGGGGG + Intronic
901490626 1:9594674-9594696 CAGGGGCCTGAGGGGGAGGCTGG - Intronic
901643079 1:10702841-10702863 CAGGGCTCTCTGCACGATGCCGG + Intronic
901887030 1:12230334-12230356 CAGGGGTCCCCGGAGGTGGCGGG - Intronic
901902823 1:12380591-12380613 CAGGGGTCTGAGAAGTAGGAAGG + Intronic
902242859 1:15100319-15100341 CAGGACCCTCAGCAGGAGGGTGG + Intronic
902515264 1:16986550-16986572 CAGCGGCCCCTGCAGGAGGCCGG + Exonic
903314394 1:22490082-22490104 CAGGGTTTTGAACAGGAGGCTGG - Exonic
903621700 1:24702793-24702815 GAGGGGGCTGAGCAGGAGACTGG - Intergenic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903928967 1:26851266-26851288 CAGCGCCCTCAGGAGGAGGCAGG + Intronic
904198171 1:28801662-28801684 CAGGGATCCAACCAGGAGGCCGG + Intergenic
904312101 1:29635550-29635572 GAGGGGTCCCAGAAGGGGGCTGG + Intergenic
905645350 1:39621553-39621575 CAGGCACCTCATCAGGAGGCGGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911577525 1:99596227-99596249 CATGGGTTTCACCAGGAAGCTGG + Intergenic
912551141 1:110486072-110486094 CAGGGGTCTCATGTGGAAGCAGG + Intergenic
912763096 1:112386289-112386311 CAAGGGAGTCAGCAGGAGCCAGG + Intergenic
912853518 1:113147314-113147336 CAGGGGGCTCTGCATGGGGCTGG + Intergenic
914846483 1:151286587-151286609 CTGGAGGCTCAGCAGGAGACGGG + Exonic
915512718 1:156395181-156395203 CAGCTGGCCCAGCAGGAGGCAGG + Intergenic
915570897 1:156744544-156744566 CAGGGCTCTGTGCAGGAGGGGGG + Intronic
915588678 1:156858927-156858949 CAGGGTTCTGAGCAAAAGGCAGG + Exonic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915901957 1:159854186-159854208 CAGGGATCTAAGCAGGAGGGAGG + Intronic
915965983 1:160308620-160308642 CAGGAGTCTCAGCTGGATCCTGG + Intronic
918309459 1:183275398-183275420 CAGGGGACTGAGCAGTTGGCTGG + Intronic
921874264 1:220176577-220176599 CACTGGTCTCAGCAGTGGGCTGG + Intronic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922870922 1:228901309-228901331 CTGGGGCCTCTGCAGGTGGCAGG + Intergenic
924625648 1:245694937-245694959 CACCGGCGTCAGCAGGAGGCTGG + Intronic
924881427 1:248165385-248165407 CACGGGTCTCAGACGGAGCCTGG - Intergenic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1063605487 10:7519826-7519848 CCTCGGTCCCAGCAGGAGGCCGG - Intergenic
1063661160 10:8035918-8035940 CAGGGGTCCCCCCGGGAGGCAGG - Intergenic
1063969569 10:11372122-11372144 CAGTGGTCCCAAGAGGAGGCCGG - Intergenic
1063990338 10:11554509-11554531 CAGGGGCCTGAGCTGGAGTCTGG - Intronic
1063993630 10:11594930-11594952 GATGGGTCCCAGAAGGAGGCAGG + Intronic
1064015938 10:11772391-11772413 CACTGGTGTCAGCAGGAGGAGGG - Intergenic
1064349168 10:14560624-14560646 CAGGGGCCTCAGCAAGAGACAGG + Intronic
1064832708 10:19489023-19489045 CAGGGGTCTCAGCAGCTCGGAGG + Intronic
1065544461 10:26805289-26805311 CAGAGGTCTGAGCAGTAGCCTGG + Intronic
1065898961 10:30188110-30188132 AGGGGGTCCCAGGAGGAGGCTGG - Intergenic
1067089000 10:43257182-43257204 CAGAGGTCACAGCAAGAGGGAGG + Intronic
1067294085 10:44964543-44964565 CATGGGTGGCAGCAGGAGTCAGG - Intronic
1067432780 10:46254805-46254827 CAGGGGTCTCTGTAAGAGGAAGG - Intergenic
1067760200 10:49039251-49039273 TTGGGGTCTCAGCAGGATGAGGG + Intronic
1069382042 10:67851201-67851223 CTGGGATCTGGGCAGGAGGCTGG + Intergenic
1070255974 10:74813552-74813574 CAGCGACCTAAGCAGGAGGCAGG - Intergenic
1070314238 10:75295225-75295247 GAGGGGTGGCAGGAGGAGGCAGG + Intergenic
1070539159 10:77403758-77403780 CAGGGTCTTCTGCAGGAGGCTGG - Intronic
1070785677 10:79160971-79160993 CTGGGGTCTCAGCTGGAGGCTGG - Intronic
1070806003 10:79271075-79271097 TAGGCGGCTCAGAAGGAGGCAGG + Intronic
1072428619 10:95351730-95351752 CTGGGCTGGCAGCAGGAGGCTGG + Intronic
1072587458 10:96795356-96795378 GAGGGGTCTCAGCAGGGGTTTGG + Intergenic
1073327509 10:102651150-102651172 CAGTGGCCTCAGCAGCAGGAGGG + Intronic
1073479803 10:103779371-103779393 CGGGGGTATCAGGAGGATGCTGG - Intronic
1074406891 10:113187561-113187583 CAGTGGTCACTGCTGGAGGCTGG + Intergenic
1075090914 10:119443851-119443873 CAGGGGTCTGAGCATGGGGGTGG + Intronic
1075121538 10:119668197-119668219 GCAGGGTCTCAGCAGGAGGGAGG + Intronic
1076324913 10:129613699-129613721 CAGGAGTCTTGGCGGGAGGCTGG + Intronic
1076533244 10:131159396-131159418 AGGGGGTCTCAGCAGGAGCTTGG - Intronic
1076550255 10:131273388-131273410 CAAGGGACTCTCCAGGAGGCAGG - Intronic
1076658153 10:132037726-132037748 CAGGAGGCTCAGCGGAAGGCGGG + Intergenic
1076697815 10:132255614-132255636 CAGGGGGCCCTGCAGGAAGCAGG + Intronic
1077065238 11:638130-638152 CAGGGTTCTCAGCAGGGGCCTGG - Intronic
1077082206 11:729154-729176 GGGGGGTCTCAGGAGGTGGCAGG - Intergenic
1077166322 11:1141046-1141068 AAGTGGGCACAGCAGGAGGCTGG + Intergenic
1077269034 11:1666451-1666473 CAGTGGACTCATCAGGATGCCGG - Intergenic
1077271514 11:1684264-1684286 CAGTGGACTCATCAGGATGCCGG + Intergenic
1077315641 11:1918285-1918307 CCGGGCACTCAGCGGGAGGCAGG + Intergenic
1077349629 11:2086450-2086472 CAGGGGACTCAGCAGGTGGACGG + Intergenic
1077459452 11:2701328-2701350 CTGTGGGCTGAGCAGGAGGCAGG - Intronic
1077922259 11:6650413-6650435 AAGGGGGGTCAGCAGGAAGCTGG + Intronic
1081657673 11:44868174-44868196 CAGGGGACGCAGTTGGAGGCTGG + Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083675727 11:64323664-64323686 CAGGGGTCCCAGGTGGGGGCAGG + Intergenic
1083791592 11:64989495-64989517 CAGGGGGCACTGGAGGAGGCTGG + Exonic
1083865007 11:65448938-65448960 AAGAGGTGTCAGCAGGAGGAGGG - Intergenic
1083886889 11:65577309-65577331 GAGGGGAGTAAGCAGGAGGCTGG + Intronic
1083889524 11:65588961-65588983 GTGGGGCCTCTGCAGGAGGCAGG + Intronic
1083935420 11:65867453-65867475 CATGGGTCTCAGCAGGAGAAGGG - Intronic
1084413660 11:69018084-69018106 GAGGGGTCTCAGCAGGGAGGTGG - Intergenic
1084477263 11:69396065-69396087 CACGGGTCTGAGGTGGAGGCAGG - Intergenic
1085339130 11:75719940-75719962 CAGGGGTCTGAGAGGAAGGCAGG - Intronic
1086445602 11:86867546-86867568 CTAGGGTCTCAGAAGGAGGATGG - Intronic
1089461815 11:118658298-118658320 CAGGAGGCTGAGCAGGAGGCTGG + Exonic
1089466191 11:118688042-118688064 CAGAAGGCTGAGCAGGAGGCTGG + Intergenic
1090258924 11:125304703-125304725 CAGGGGTCTGCACAGGATGCAGG + Intronic
1090384296 11:126347711-126347733 CTGGGGTCTTGGCAGGAGGTTGG + Intergenic
1090429972 11:126637474-126637496 CAGAGGCTTGAGCAGGAGGCTGG - Intronic
1090452697 11:126820708-126820730 CAGCGGGCACAGCAGCAGGCTGG + Intronic
1091284942 11:134403291-134403313 CAGGGATGAGAGCAGGAGGCTGG + Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092573436 12:9750944-9750966 CAGGGGACTTAGCCGGGGGCAGG + Intergenic
1092653872 12:10664341-10664363 CAGTGGTCTCTGTAGGAGGATGG - Intronic
1092735080 12:11574458-11574480 CAGTGGGCTCATCAGGAGACTGG - Intergenic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1095722335 12:45414099-45414121 TGAGGGTCTCAGCAGGATGCGGG + Intronic
1096374879 12:51100707-51100729 CAGGGATCTAGGCAGGAGGATGG + Intronic
1096590430 12:52655377-52655399 GAGGCGAGTCAGCAGGAGGCTGG + Intergenic
1096735387 12:53649306-53649328 CAGAAGACTCAGCAAGAGGCTGG + Intronic
1096916000 12:55034405-55034427 CAGTGGGCTGAGCAGGAGCCAGG - Intergenic
1097183617 12:57184695-57184717 CAGGAGTGTATGCAGGAGGCAGG + Intronic
1099070190 12:78036523-78036545 CACATGTCTCAGCAGGAGGATGG - Intronic
1100386507 12:94109157-94109179 GAGGGGCCTCAGCTTGAGGCAGG + Intergenic
1100395848 12:94185766-94185788 CAGGAGTGTCAGCAGGAGTTTGG - Intronic
1101321509 12:103677013-103677035 GAGGAGCCTCACCAGGAGGCTGG - Intronic
1101942632 12:109111235-109111257 CTGGGGTCTCAGCTGGCAGCCGG - Intergenic
1102031424 12:109742048-109742070 CAGGGGCCACAGAAAGAGGCTGG + Intronic
1102113991 12:110387123-110387145 CAGGAGGCTGAGCAGGAGGATGG + Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1102824943 12:115941158-115941180 CATGGTTCATAGCAGGAGGCTGG - Intergenic
1103520800 12:121536218-121536240 CCGGGGGCTCAGCAGTATGCAGG + Intronic
1103703358 12:122859151-122859173 CAGGGGTGTCCGCACCAGGCTGG - Exonic
1104367752 12:128193218-128193240 CAGGGGTGTCAGCATCAGTCAGG - Intergenic
1104750768 12:131236711-131236733 CAGAAGTCACAACAGGAGGCCGG + Intergenic
1104797200 12:131528079-131528101 CAGGGCTCCCAGCAGGAGATGGG + Intergenic
1105611520 13:21973676-21973698 AGGGGGTGTCACCAGGAGGCGGG - Intergenic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106229356 13:27809809-27809831 CAGAGTTCTCAGCAGGGGGTTGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1107888458 13:44893889-44893911 CAGGGATCTGGACAGGAGGCAGG + Intergenic
1108450524 13:50558205-50558227 GAGGGGCCTCAGCAGGAGGCAGG + Intronic
1108524934 13:51278558-51278580 CCTGGGTGGCAGCAGGAGGCAGG - Intronic
1108685199 13:52813447-52813469 CAGAGGTTTCAGCAGAAGGCTGG + Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113371249 13:109727517-109727539 CAGGGGTCATTGCAGGAGACGGG + Intergenic
1113428643 13:110230590-110230612 CAGTGGCTTCTGCAGGAGGCTGG - Intronic
1113453817 13:110433119-110433141 CAGGGGTCACAGCAATGGGCAGG - Intronic
1113561574 13:111285850-111285872 GAGAGGTGTCACCAGGAGGCAGG - Intronic
1113762532 13:112859574-112859596 CAGGGTGCCCAGCAGCAGGCGGG + Intronic
1113843089 13:113371423-113371445 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843097 13:113371443-113371465 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843113 13:113371482-113371504 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843130 13:113371522-113371544 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843147 13:113371562-113371584 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843164 13:113371602-113371624 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843181 13:113371642-113371664 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843198 13:113371682-113371704 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843213 13:113371721-113371743 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843221 13:113371741-113371763 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843258 13:113371839-113371861 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113885687 13:113657306-113657328 CAGGGGTCGCAGGGGGAGGTGGG + Intronic
1114046446 14:18880524-18880546 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1114117766 14:19638926-19638948 CAGGGGCCTCTGGAGGGGGCGGG - Intergenic
1114183571 14:20384004-20384026 CAGGGGCCTGGGCAGGAGGGAGG - Intronic
1114587161 14:23825622-23825644 CAGCTGGCTCAGCAGCAGGCTGG + Intergenic
1114636251 14:24188540-24188562 CAGGGGTCTCACCTGGGGGTCGG + Exonic
1114906239 14:27130641-27130663 CAGAGATCTCAGTAGGAGGCTGG - Intergenic
1116470788 14:45283102-45283124 TATGGGTCTCAGCAGGAAACAGG - Intergenic
1117011637 14:51476395-51476417 CAGGTGTCTCAGCATTAGGTTGG - Intergenic
1117336027 14:54758040-54758062 CAGATGTCTCTGCAGGAGTCAGG - Intronic
1118393432 14:65315797-65315819 CAGAGGTCTCATCAGAAGGTGGG - Intergenic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1118816118 14:69315394-69315416 AAGAACTCTCAGCAGGAGGCTGG + Intronic
1118867325 14:69713624-69713646 CAAGGGTAGCAGCAGGTGGCAGG + Exonic
1118875468 14:69781261-69781283 CACTTGTCTCAGCAGGAGACAGG - Intronic
1119323735 14:73746430-73746452 CAGGGATCCCAGCAGGAGTAGGG + Intronic
1120600322 14:86496362-86496384 CAGTGGTGACAGCAGCAGGCAGG + Intergenic
1121000228 14:90446582-90446604 CACTGGTCCCAGCAGGAGGCGGG + Intergenic
1121057996 14:90876721-90876743 CAGTGGTGTCGGCAGGAGCCTGG + Intronic
1121417864 14:93791335-93791357 CAGGGGCGTCAGCAGGATGTGGG - Intergenic
1122429464 14:101630605-101630627 CAGGGGCCCGGGCAGGAGGCAGG - Intergenic
1122638026 14:103139229-103139251 CAGGAGACTCCGCAGGAGGAAGG + Intergenic
1122798798 14:104219731-104219753 CAGAGGTCTCTGCAGGTGCCCGG + Intergenic
1122882237 14:104695338-104695360 CAGGGGTCTGGGCTGGAGTCTGG - Intronic
1123113256 14:105882652-105882674 CAAGGGTCCCGGCAGGAGCCAGG + Intergenic
1123115610 14:105892803-105892825 CAAGGGTCCCGGCCGGAGGCAGG + Intergenic
1124079229 15:26475728-26475750 CAGGGCTCACTGCAGGACGCAGG - Intergenic
1124183261 15:27498611-27498633 CTGTAGTCCCAGCAGGAGGCTGG - Intronic
1128151055 15:65363659-65363681 CAGGGGTCCTGGCAGGAGGCGGG - Intronic
1128369491 15:67030046-67030068 CAGGTGTCTGAGCAGATGGCTGG + Intergenic
1128455628 15:67829839-67829861 CCGCGTTCTCAGCAGGAGTCGGG + Intronic
1129331847 15:74831907-74831929 CAGGGGCCTGGGCAGGAGGAAGG + Intergenic
1129737520 15:77974499-77974521 CAGGGTTCTCAGTAGAAGTCTGG + Intergenic
1129845856 15:78767432-78767454 AAGGGGTTTCAGTAGGGGGCCGG + Exonic
1129848547 15:78779120-78779142 CAGGGTTCTCAGTAGAAGTCTGG - Intronic
1130059306 15:80558199-80558221 CAAGGGACTTAGAAGGAGGCTGG - Intronic
1130081780 15:80740131-80740153 CACAGGTCTGAGCAGGTGGCAGG - Intronic
1130253375 15:82314826-82314848 CAGGGTTCTCAGTAGAAGTCTGG + Intergenic
1130256008 15:82326428-82326450 AAGGGGTTTCAGTAGGGGGCCGG - Intergenic
1130435996 15:83900600-83900622 AAGGGGTCTCAGCAGTAATCTGG + Intronic
1130598946 15:85263558-85263580 AAGGGGTTTCAGTAGGGGGCCGG + Intergenic
1130960421 15:88655244-88655266 TAGGAGACTCAGCAGGTGGCTGG - Intronic
1132392141 15:101446999-101447021 AAGGTGACACAGCAGGAGGCAGG + Intronic
1132404057 15:101531563-101531585 CACGGGTCGCAGCATGTGGCAGG - Intergenic
1132519077 16:379131-379153 CAGTGGACACAGCAGGGGGCGGG + Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132726165 16:1339210-1339232 CAGGGCTCTCAGGCCGAGGCTGG - Exonic
1132819928 16:1859910-1859932 CTGGAGCCTCAGCAGGAGCCGGG - Intronic
1133127128 16:3654360-3654382 CAGGCAACTCTGCAGGAGGCTGG - Intronic
1134022521 16:10930883-10930905 CAGGTGTCTCAGGAGCAGGCTGG - Exonic
1134029214 16:10978334-10978356 AAAGGGCCTCAGCAGGAGGCAGG + Intronic
1135423827 16:22322590-22322612 CAGGGGTCTTAGGATGAGGCTGG + Intronic
1135733781 16:24915085-24915107 CTGGGATCTCATCTGGAGGCTGG - Intergenic
1136235056 16:28908640-28908662 CAGGGCTCGCAGCAGGAGCAGGG - Exonic
1138021111 16:53482367-53482389 AAGGGCACTCAGCAGGAAGCAGG + Intronic
1138791650 16:59911312-59911334 CCAGGAGCTCAGCAGGAGGCAGG - Intergenic
1139532273 16:67548199-67548221 CAGGGGTCCCTGGAGGAGGCCGG + Intergenic
1141626616 16:85264763-85264785 CAGGGGTCTCCACAGGGGACGGG - Intergenic
1141710585 16:85696697-85696719 CAGGAGACTCACCTGGAGGCAGG + Intronic
1141718791 16:85743130-85743152 CTGTGGTCTCTGCAGGAGGCTGG - Intronic
1141769803 16:86082929-86082951 CAGGTGTCCGAGGAGGAGGCAGG + Intergenic
1142197553 16:88745794-88745816 CAGGGCTCTCAGGAGGAAACAGG + Intronic
1142359559 16:89619738-89619760 CAGGGGGCACAGCAGGCTGCAGG - Intronic
1142713602 17:1736400-1736422 CAGGGGTCTCAGCAGGAGGCAGG + Intronic
1142956546 17:3526898-3526920 CGAGGGTCTCAGCAGGAAGATGG + Exonic
1142986483 17:3698138-3698160 CAGGGGGCTGAGGAGGAGGCTGG - Intergenic
1143025929 17:3942016-3942038 TAGGGGCCTCAGCAGCAGGGAGG + Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143561802 17:7700908-7700930 CAGGGGTCTTTGGAGGAGGAAGG + Intronic
1144421269 17:15101363-15101385 GAGGGGATTCAGCAGGAGACCGG - Intergenic
1144501243 17:15787715-15787737 TGGGGGTCACAGCCGGAGGCTGG - Intergenic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1145163412 17:20590389-20590411 TGGGGGTCACAGCCGGAGGCTGG - Intergenic
1145879826 17:28344878-28344900 GAAGGTTCTCAGCAGGAGGTGGG - Exonic
1146279676 17:31537054-31537076 GATGGGCCCCAGCAGGAGGCAGG - Exonic
1147424389 17:40339100-40339122 CAAGGGCCTCAGCAGGAAGCAGG - Intronic
1147587525 17:41660881-41660903 CAGGGGATTCACCAGGAGGAGGG + Intergenic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148128453 17:45248509-45248531 CAGGGGTCCCTGCGGGGGGCAGG + Intergenic
1148860139 17:50600430-50600452 CAGGGGGCTGGGCTGGAGGCAGG + Intronic
1149662012 17:58338996-58339018 CTGGGGAATCAGCTGGAGGCAGG - Intergenic
1149991674 17:61387084-61387106 CAGGGGCCCCAGCAGTAGGTCGG - Intronic
1150118440 17:62577151-62577173 CGGGGGTCTCACCATTAGGCTGG + Intronic
1150143590 17:62750252-62750274 CAGGGGTCTCAGCCGGAGTGGGG + Intronic
1150641233 17:66951172-66951194 AAGGCTTCTGAGCAGGAGGCAGG - Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151600002 17:75100275-75100297 CAGGTGTCTCGGGAGGTGGCGGG - Exonic
1151718859 17:75844631-75844653 CAACGCTCTCAGCAGGGGGCGGG + Exonic
1151964703 17:77425344-77425366 AAGGGCTCTCAGCTGCAGGCAGG - Intronic
1152283698 17:79400257-79400279 CCGGAGTCTCAGCAGGAGCTTGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152591585 17:81216028-81216050 CAGGGGTCTCACTAGGTTGCTGG - Intronic
1152598491 17:81249693-81249715 CATGGGTCTCAACAGGTGGGTGG - Intronic
1152742489 17:82024421-82024443 CTGGGGTCTGGGCAGGTGGCTGG + Intronic
1152922303 17:83072245-83072267 CAGGAGTCAGGGCAGGAGGCTGG - Intergenic
1153973575 18:10247592-10247614 CTGGGGTGTCAGCACGGGGCTGG + Intergenic
1154306464 18:13234230-13234252 GAGGAGCCTCAGCAGGAGGGAGG - Intronic
1155616325 18:27725608-27725630 CTAAGGTGTCAGCAGGAGGCTGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1157555598 18:48611018-48611040 CAGGGGTCCCTGGAGAAGGCAGG + Intronic
1158660576 18:59383974-59383996 CAGATGCTTCAGCAGGAGGCTGG - Intergenic
1160208667 18:76858706-76858728 GAGAGGGCTCAGCTGGAGGCAGG + Intronic
1160208681 18:76858750-76858772 GAGAGGGCTCAGCTGGAGGCGGG + Intronic
1160208708 18:76858838-76858860 GAGAGGGCTCAGCTGGAGGCGGG + Intronic
1160208722 18:76858882-76858904 GAGAGGGCTCAGCTGGAGGCGGG + Intronic
1160208778 18:76859058-76859080 GAGAGGGCTCAGCTGGAGGCGGG + Intronic
1160208792 18:76859102-76859124 GAGAGGGCTCAGCTGGAGGCGGG + Intronic
1160208820 18:76859190-76859212 GAGAGGGCTCAGCTGGAGGCAGG + Intronic
1160403489 18:78628720-78628742 CTGTAGTCTCTGCAGGAGGCGGG - Intergenic
1160694153 19:474522-474544 CTGGGAGCCCAGCAGGAGGCAGG - Intronic
1160929521 19:1563605-1563627 TTGGGGTCTCAGCAGGAGCAGGG + Intronic
1161086868 19:2339493-2339515 CAGGCGGCTCAGCAGGAAGAGGG - Intronic
1161266093 19:3365513-3365535 CTGGGGGCTCAGACGGAGGCAGG + Intronic
1161286756 19:3472300-3472322 AGGGGGTCTCAGCTGGAGTCAGG + Intergenic
1161310260 19:3589970-3589992 CAGGGGTCCCAGCGGGAAGTTGG + Intronic
1161327333 19:3670121-3670143 CAGGAGCCTCTGCAGGCGGCAGG + Intronic
1161333245 19:3698163-3698185 CATGGGCCTCAGCAGGGGCCTGG + Intronic
1161364338 19:3869363-3869385 CAGGGCTCTGAGTAAGAGGCGGG - Intergenic
1161814583 19:6492014-6492036 CTGGGGGCTCAGCAGGAGTAAGG - Intergenic
1163615187 19:18322978-18323000 GCGGGGTCTCACCGGGAGGCGGG - Intronic
1163815542 19:19462603-19462625 CAGGGTCCTCAGCAGAGGGCTGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164717929 19:30407075-30407097 CTGGGGTCACAGCAGGTGGCTGG + Intronic
1164821542 19:31254950-31254972 CAGGTGCCTCAGCAGGAGTGGGG + Intergenic
1165062433 19:33211369-33211391 CAGGGGCCTGGGCAGGAGCCAGG + Intronic
1165933478 19:39375260-39375282 CAGGGATTTGAGCAGGAGTCAGG + Intronic
1166067220 19:40366890-40366912 CAAGGGTCATAGCAGGGGGCTGG - Exonic
1166108246 19:40608091-40608113 CAGGGGTTTGAGCTGGAGGCTGG - Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166542046 19:43611929-43611951 GAGGGGTCCCAGCCTGAGGCTGG - Intronic
1167100857 19:47403529-47403551 TGGGGGTCACAGCCGGAGGCTGG + Exonic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167601729 19:50458876-50458898 GAGGGGGCTCAGCGGGGGGCCGG - Intronic
1167615599 19:50531187-50531209 CGGGGGAGTCAGCAGGAGCCTGG - Intronic
1167752536 19:51389329-51389351 CAGGGCGCTGTGCAGGAGGCAGG + Exonic
1168295171 19:55374609-55374631 GAGGGGGCTCTGCAGGGGGCCGG - Intergenic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168400993 19:56086356-56086378 CTGGGGCCTCATCTGGAGGCAGG - Intergenic
1168502710 19:56906855-56906877 GAGGGGTCTAAGCAGGATCCTGG + Intergenic
925238110 2:2296978-2297000 CAGGTTTCTCTGCAGGAAGCTGG + Intronic
925284588 2:2707392-2707414 CAGGCGGCTCAGCAGGACACAGG + Intergenic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
926082238 2:9996880-9996902 CGAGGATCTCAGCACGAGGCTGG + Intronic
927577633 2:24212686-24212708 CATGGGTTTCAGCAGGAAGCTGG + Exonic
927650282 2:24908841-24908863 CATGGGTCCCGGCAGGAAGCAGG + Intronic
927672276 2:25078817-25078839 CAGGGAGCTCAGCAGGTGTCAGG + Intronic
927702298 2:25276223-25276245 CAGGGGCCTGAGCATGGGGCAGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927884385 2:26709732-26709754 CATGGGTCTCTGCAGGGGGAGGG - Intronic
928042648 2:27893697-27893719 AAGGTGTATCAGCAGTAGGCCGG + Intronic
929470748 2:42190263-42190285 GGGGGGACTCAGCAGGAGGAGGG - Intronic
929570998 2:43022841-43022863 CAGGGTTCTTAACAGGAGGATGG - Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
931184417 2:59936210-59936232 CAGTGGTCTAAGCAGGAGCCAGG - Intergenic
932347586 2:71005803-71005825 GAGGGGTTTGCGCAGGAGGCAGG - Intergenic
932455798 2:71849185-71849207 CAGGCGTCTCCCCAGGGGGCAGG + Intergenic
932494718 2:72140652-72140674 GAGGTGCCTCAGCAGGAGGACGG - Intronic
932571049 2:72938564-72938586 CAGGAGTCCCAGCAGGAAACTGG - Intergenic
933102622 2:78280099-78280121 CAGGGGTCCAGGCAGAAGGCAGG - Intergenic
933464899 2:82639698-82639720 TGGGGGTCTCAGAAGAAGGCAGG + Intergenic
933916808 2:87003110-87003132 CTGGGGTCTCATCTGAAGGCTGG - Intronic
934006186 2:87766804-87766826 CTGGGGTCTCATCTGAAGGCTGG + Intronic
934121477 2:88844479-88844501 CATGGCACTGAGCAGGAGGCAGG + Intergenic
935680923 2:105636320-105636342 CAGGTGTCTGATCAGGGGGCAGG - Intergenic
935769787 2:106407077-106407099 CTGGGGTCTCATCTGAAGGCTGG + Intronic
935910307 2:107888843-107888865 CTGGGGTCTCATCTGAAGGCTGG - Intronic
935968429 2:108505691-108505713 CTGGGGTCTCATCTGAAGGCTGG - Intronic
936132099 2:109853986-109854008 CTGGGGTCTCATCTGAAGGCTGG - Intronic
936212598 2:110517499-110517521 CTGGGGTCTCATCTGAAGGCTGG + Intronic
936421736 2:112372079-112372101 CTGGGGTCTCATCTGAAGGCTGG + Intronic
936574773 2:113643943-113643965 TTGTGGTCTCAGCTGGAGGCCGG + Intergenic
937238086 2:120442587-120442609 TGGGGGTGGCAGCAGGAGGCTGG + Intergenic
937912362 2:127081789-127081811 CTGGGGTCTCAGCAGCTGGGTGG - Intronic
938105691 2:128528451-128528473 CAAGGATCCCAGCAGGAGGGAGG - Intergenic
938297168 2:130185570-130185592 CAAGGGTTACAGCAGGAGGGGGG + Intronic
938364923 2:130727084-130727106 GATGATTCTCAGCAGGAGGCAGG + Intergenic
938558210 2:132445882-132445904 CAGCGGGCTCAGGAGGAGACAGG + Intronic
938679925 2:133679014-133679036 AAAGGGTCTCAGCATGGGGCGGG + Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
941908631 2:170741092-170741114 CCGGTTTCTCAGCAGGTGGCTGG - Intergenic
945169801 2:206983548-206983570 ATGGGGACTCAGCAGAAGGCAGG + Intergenic
945692497 2:213056341-213056363 CACAGGTCTCAGTAGCAGGCAGG - Intronic
946023994 2:216660833-216660855 GTGGGGTCTCAGCTGGAGGAGGG + Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947734287 2:232446715-232446737 CAGGGGGCACCGCAGGAGGCAGG - Intergenic
948909337 2:240995217-240995239 CAAGGCTCTCAACGGGAGGCAGG + Intergenic
1170042491 20:12053141-12053163 GAGGGGACTCAACTGGAGGCTGG + Intergenic
1171401122 20:24873537-24873559 CAGGGGTGTCAGGAGGAAGTAGG - Intergenic
1171482189 20:25462343-25462365 CAGGGAGCTGAGCTGGAGGCTGG - Intronic
1171487986 20:25497707-25497729 CTGGGCTGTCAGCAGGAGGAAGG - Intronic
1172057879 20:32166687-32166709 CAGGGGTCTACGGAGGAGCCAGG - Exonic
1172978205 20:38921943-38921965 CCTGGGTCTCAGCAGGAGCTAGG - Exonic
1173647553 20:44642873-44642895 CAGGGAGCTGGGCAGGAGGCAGG + Intronic
1173838398 20:46140288-46140310 CATGGGGCTCTGCAGGGGGCGGG + Intergenic
1174168901 20:48604255-48604277 CCGGGGCTTCTGCAGGAGGCAGG + Intergenic
1174180316 20:48670304-48670326 CAGGGTTCTCAGCAGGGGCAGGG - Intronic
1174183312 20:48688602-48688624 CTGGGCTCTCAGCTGGAGGTGGG - Intronic
1174339021 20:49884535-49884557 CAGGTGTCTCAGCTGCTGGCAGG - Intronic
1174361056 20:50029277-50029299 CAGGTGTCTCTGGAGGAGCCAGG + Intergenic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174838731 20:53881573-53881595 CAGGGGCCTAGTCAGGAGGCTGG - Intergenic
1175227783 20:57454905-57454927 CTGGGGATTCTGCAGGAGGCTGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175643380 20:60649946-60649968 CCGGGGGCCCAGCAAGAGGCAGG - Intergenic
1175771627 20:61627926-61627948 CAGGGGGCCCAGGAGGCGGCTGG - Intronic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1176062124 20:63177007-63177029 CAGGGCCATCCGCAGGAGGCCGG + Intergenic
1179430704 21:41319217-41319239 CAGGGGTCTCAGGAGGGTCCTGG - Intronic
1179660475 21:42871407-42871429 CAGGGATCTCTGCAGGTGGCAGG - Intronic
1179875653 21:44266051-44266073 GAGCGGTCTCAGCAGGAGAGAGG + Intergenic
1180000821 21:44994780-44994802 CAGGAGTCTCACCACGAAGCAGG - Intergenic
1180464982 22:15603160-15603182 CAGGGGCCTCTGGAGGGGGCGGG + Intergenic
1180791616 22:18578090-18578112 CAGCGGTCCCAGCACTAGGCGGG + Intergenic
1181150364 22:20878818-20878840 TAGGGGGCTCAGCAGGATGTCGG + Intronic
1181230124 22:21417220-21417242 CAGCGGTCCCAGCACTAGGCGGG - Intergenic
1181248525 22:21517646-21517668 CAGCGGTCCCAGCACTAGGCGGG + Intergenic
1182334095 22:29571536-29571558 CCAAGGTCCCAGCAGGAGGCAGG + Intronic
1182427448 22:30282448-30282470 GAAGGGCCTGAGCAGGAGGCAGG - Intergenic
1182555227 22:31125498-31125520 CAGATGTCTGAGCTGGAGGCTGG - Exonic
1182897809 22:33873425-33873447 CAGGGCTTTCAGCCGGGGGCAGG - Intronic
1183489866 22:38110537-38110559 CCCGGGTCTGAGCAGGAGGCTGG + Exonic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1184092278 22:42299072-42299094 CAGGGGTCTGGGCAGGCGGTGGG - Intronic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184511938 22:44939092-44939114 AAGGGGTCTTGGCAGAAGGCAGG - Intronic
1185116468 22:48941040-48941062 CAGGGCTCACAGTAGGAGCCAGG + Intergenic
1185425400 22:50766933-50766955 TTGTGGTCTCAGCTGGAGGCCGG - Intergenic
950028993 3:9839524-9839546 CAGTGGTATCAGCAGCAGCCTGG - Intronic
950228900 3:11259105-11259127 CAGGGGCATCAGCTGGGGGCTGG - Exonic
950562793 3:13744841-13744863 CCTGGTTCTCAGCAGGGGGCAGG - Intergenic
950661548 3:14469789-14469811 CAGGGGTCTCAGGATGGGGCTGG - Intronic
952033710 3:29175046-29175068 CAGAGGCCTCAGCAGGATCCAGG + Intergenic
952283026 3:31941579-31941601 CAGGGATCTTGGCAGTAGGCAGG - Intronic
953391222 3:42534989-42535011 CAGGGGGATCAGCAGGAGTGTGG - Exonic
953461935 3:43088511-43088533 CGTGGGTGTCAGCAGGAGGGTGG - Intronic
953531692 3:43745494-43745516 CAGTGGGCACAGCAGGCGGCAGG + Intergenic
953645480 3:44749893-44749915 CAGGAGGCTAAGCAGGAGGATGG - Exonic
953679361 3:45028072-45028094 CATGGGTTTCAGCGAGAGGCAGG - Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954423698 3:50432247-50432269 CAAGGGGCTGGGCAGGAGGCTGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954671619 3:52294170-52294192 AAGGGGGCTCAAAAGGAGGCAGG - Intergenic
954681296 3:52347403-52347425 CTGAGGTCTCAGCTGGGGGCTGG + Intronic
954688701 3:52384452-52384474 CAGGGCTCTCAGAGAGAGGCAGG + Intronic
954707935 3:52491013-52491035 CAGGGCTCAGAGCAGGAGGTAGG + Intronic
955343925 3:58147051-58147073 CAGGGGTCTGATAAGGAGGGTGG - Intronic
958844278 3:99246752-99246774 CAGAGGTCCCAGCAGGAACCTGG + Intergenic
959516278 3:107270452-107270474 CTGGGGTCTCATCTGAAGGCTGG + Intergenic
960971666 3:123144145-123144167 CCGGGTGCTCAGCTGGAGGCAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961499808 3:127324151-127324173 CAGGAGCCTCCCCAGGAGGCCGG - Intergenic
962869225 3:139473720-139473742 CAGGGGGCTCAGCTAGAAGCAGG - Intronic
966318755 3:178677583-178677605 CAGGGGTTTTAGGAGGAGGCTGG - Intronic
966933559 3:184691290-184691312 CAGGGGTCTCACAATAAGGCAGG - Intergenic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967846655 3:194048540-194048562 CAGAGGTCTTGTCAGGAGGCTGG - Intergenic
967955053 3:194871687-194871709 CAGTGTCCTCAGCAGGAGCCCGG - Intergenic
968058554 3:195711478-195711500 CAGGAGACTCACCAGGAGCCAGG - Intergenic
968521788 4:1037516-1037538 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968521808 4:1037596-1037618 CAGGGCTGCCTGCAGGAGGCTGG - Intergenic
968905111 4:3447353-3447375 GAGGGGTCTGAGCAGGTGCCTGG - Intronic
969260904 4:6032845-6032867 TGAGGGTCTCAGCGGGAGGCGGG + Intronic
969511576 4:7620944-7620966 CAGGGGTCGCAGCAGGAGAAGGG - Intronic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969697724 4:8744590-8744612 CATGGGGTTCAGCTGGAGGCTGG - Intergenic
969754227 4:9137861-9137883 ATGTGGTCTCAGCAGGAGACTGG + Intergenic
969814124 4:9674137-9674159 ATGTGGTCTCAGCAGGAGACTGG + Intergenic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971324994 4:25636399-25636421 CAGGGGTCTCTGCAGACAGCAGG + Intergenic
972361376 4:38328554-38328576 CAGTGGTCTCTGCAGAAGGCCGG + Intergenic
973856199 4:55012667-55012689 GATGGGTCTCAGCAGAAGACTGG - Intergenic
974842034 4:67309844-67309866 TAGGGGGCTCAGAAGAAGGCAGG + Intergenic
981914247 4:150016272-150016294 CAGAGGTCTCAGAAGAAGACAGG - Intergenic
982090786 4:151878311-151878333 GAGGGGTCTCTGCAAGGGGCAGG + Intergenic
982131582 4:152233728-152233750 CCAGGGTGTCAGCAGGAGGCTGG - Intergenic
985733214 5:1563150-1563172 AAGGGGTCTCAGGAGGTAGCAGG + Intergenic
985763210 5:1762484-1762506 CAGGGGTCCCTGTCGGAGGCTGG + Intergenic
985867335 5:2524320-2524342 GAGGAGTCTCAGGAGGATGCGGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986335546 5:6752520-6752542 CAGGGGTCACAGCCCAAGGCTGG - Intronic
986674189 5:10168980-10169002 GGGGGGTCTCAGGAGCAGGCTGG - Intergenic
989817781 5:45757189-45757211 CAGGAATCACAGCAGAAGGCTGG - Intergenic
990247119 5:53874201-53874223 CAGGCCTCACAGCAGGAGGTGGG - Intergenic
990743177 5:58933197-58933219 CAGGAGATTCTGCAGGAGGCCGG + Intergenic
992507956 5:77406608-77406630 GAGGTGGCTGAGCAGGAGGCAGG + Intronic
996818193 5:127596700-127596722 CAGAGGTCGCAGCAGGAGACCGG + Intergenic
997249125 5:132375322-132375344 CATTGATTTCAGCAGGAGGCAGG + Intronic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
1001435072 5:171693738-171693760 CAGGTCCCCCAGCAGGAGGCTGG - Intergenic
1001567109 5:172706912-172706934 AAGGGGGCACAGCAGGGGGCGGG + Intergenic
1001786183 5:174415729-174415751 CAGAGGTCCCAGCGGGAGACAGG - Intergenic
1001872718 5:175170742-175170764 CAGAAGGCTCAGCAGGAGACAGG - Intergenic
1002297535 5:178239883-178239905 CACGGCTCTCAGCAGGACCCAGG - Intronic
1002462038 5:179378755-179378777 CAGGGATCTGAGAAGCAGGCAGG - Intergenic
1002761507 6:205988-206010 CAGGTGACTCAGCAGGAGGCTGG - Intergenic
1002790998 6:437371-437393 CAGGGGTCTCAGCTAGGTGCAGG + Intergenic
1003502995 6:6717541-6717563 CAGGAGTCTCAACTGGGGGCTGG - Intergenic
1006021754 6:31121522-31121544 CAGGGGCCAGAGCAGGAGGGAGG - Intronic
1006289037 6:33120207-33120229 CAGGGAGCTAAGCAGGCGGCAGG - Intergenic
1006443372 6:34065602-34065624 CTGGGGTCCTGGCAGGAGGCTGG - Intronic
1007516813 6:42419267-42419289 GAGGGGACTCAGCAGAAGCCGGG - Intronic
1011142213 6:84171068-84171090 TAGTGGTCTCAGCTGGAGACTGG - Intronic
1012258912 6:97065000-97065022 CAGGGTTCCCTGCAGGAGCCGGG + Intronic
1013391461 6:109690377-109690399 TGGGGGTCCCCGCAGGAGGCGGG + Intronic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017871163 6:158487892-158487914 CTGGGGTTAAAGCAGGAGGCAGG + Intronic
1017885250 6:158594039-158594061 CAGGGGTGTGAGGAGGAGGGAGG - Intronic
1018141227 6:160838871-160838893 CAGGGGTTTCGACATGAGGCTGG - Intergenic
1018545888 6:164934781-164934803 CAGGCGCCTCAGCAGGATGAGGG + Intergenic
1018746786 6:166768525-166768547 TAGGAGTTTCAGCAGGAGACTGG + Intronic
1019054425 6:169213249-169213271 CAGGGGTGTGCGCTGGAGGCCGG + Intergenic
1019134365 6:169899092-169899114 CGGGGCGCTCAGCAGGGGGCGGG - Intergenic
1019254573 7:41049-41071 CAGGCCTCTCAGCAGGAGCTCGG + Intergenic
1019377259 7:699434-699456 CAGAGGTCACAGCTGGAGGAAGG + Intronic
1019487104 7:1294390-1294412 CAGGGGTGTGACCAGGAGGAGGG - Intergenic
1019601533 7:1886073-1886095 CACGGGTCTCTGCAGGTTGCTGG - Intronic
1019612241 7:1942372-1942394 CTGTGGTCACAGCAGCAGGCTGG - Intronic
1019971269 7:4542860-4542882 CTGAGGCCTCAGCGGGAGGCTGG + Intergenic
1021575545 7:22102655-22102677 CAGAGCTCTCAGAAGGAGCCAGG - Intergenic
1021668650 7:23013575-23013597 CCCGGGTCACAGCAGGAGGCTGG + Intronic
1022873927 7:34508285-34508307 CAAGGGTCTAGGCAGGAGACTGG + Intergenic
1023595980 7:41829866-41829888 CACAGGTCCCAGAAGGAGGCTGG - Intergenic
1024064166 7:45718879-45718901 CAGTGGGCTCAGCAGAAGGAAGG + Exonic
1024236933 7:47406030-47406052 CAGCGGGCTCATCAGGAGTCTGG - Intronic
1029283064 7:99449117-99449139 CAGGGAGCCCGGCAGGAGGCTGG + Intronic
1034825225 7:154256320-154256342 CAGGGGCCCCTGCAGAAGGCAGG + Intronic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1035786818 8:2267868-2267890 CAGGGTTATCTGCAGGAGACAGG - Intergenic
1035805989 8:2453848-2453870 CAGGGTTATCTGCAGGAGACAGG + Intergenic
1035814612 8:2526125-2526147 CAGGGATCTCAGAAGGATGAAGG + Intergenic
1036528407 8:9556460-9556482 CAGGGGTCCCAGCAGTGAGCGGG + Exonic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1036662477 8:10716896-10716918 TCAGGGTCTCAGCAGGGGGCAGG - Intergenic
1037018593 8:13940290-13940312 CATGGGACTCAGCAAGTGGCTGG - Intergenic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1039418180 8:37413646-37413668 GAGTGGGCTCAGCAGGAGGTGGG + Intergenic
1039562987 8:38528001-38528023 AGGGGGTTTCAGCAGGAAGCGGG + Intronic
1039604377 8:38868488-38868510 CAGGTGTCTGAGCAGGAGACTGG + Intergenic
1041434088 8:57818106-57818128 CAGTGGTGGCAGCAGCAGGCTGG - Intergenic
1044609732 8:94079950-94079972 CAGGTGTCTCTGCAGGTGGCTGG + Intergenic
1045288225 8:100810151-100810173 CTGGGCTCTGGGCAGGAGGCAGG - Intergenic
1048439242 8:134447800-134447822 CAGGTGCCTCTTCAGGAGGCTGG - Intergenic
1048692548 8:136983846-136983868 CAGGTGTCTCAGCTGGCGGCAGG + Intergenic
1048988340 8:139747469-139747491 CAGGGGTCAGAGCAGGTGGGAGG + Intronic
1049199877 8:141334805-141334827 CCGGGCACCCAGCAGGAGGCTGG - Intergenic
1049420426 8:142513995-142514017 CAGGGGTCCCAGCAGGAGTGAGG + Intronic
1051852052 9:21520710-21520732 CAGTGGTGTCAGCTGAAGGCTGG + Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053149903 9:35736741-35736763 GGGGGGTCTCAGCAGGAGCCTGG + Exonic
1053159007 9:35800645-35800667 CTGGGGTCTGGGGAGGAGGCTGG + Intronic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053418192 9:37959845-37959867 CAGGGGGCTCACCGGGAGCCAGG - Intronic
1053446786 9:38158941-38158963 CAGGGGTCTGAGCAAGAAGCGGG + Intergenic
1053577288 9:39365332-39365354 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1053841788 9:42193257-42193279 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054098859 9:60924022-60924044 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054120257 9:61199643-61199665 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054587495 9:66982911-66982933 CAGAGTTCTCACCAGGAGCCTGG - Intergenic
1054766254 9:69045002-69045024 CAGGGTGGTTAGCAGGAGGCTGG - Intronic
1055416235 9:76086456-76086478 CAGAGGCCTCAGCAGGACTCAGG - Intronic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056438567 9:86597332-86597354 CAGGGCCCTCTGCAGGAGCCTGG - Intergenic
1056675575 9:88674087-88674109 CAGGGGTCTCAGCTGAAGCTTGG + Intergenic
1056806903 9:89736055-89736077 CTGAGGTCTCATCTGGAGGCTGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1060197273 9:121631877-121631899 CAGGGCTTTCAGCAGGGAGCAGG + Intronic
1060497653 9:124130163-124130185 AAGGGGTCTACCCAGGAGGCTGG - Intergenic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060911786 9:127357093-127357115 CACGGGGCTCTGCAGGAGCCTGG + Intronic
1061256137 9:129454831-129454853 GAGGGGTCTGAGGAGGAGTCAGG - Intergenic
1061396378 9:130346076-130346098 CAGCGGTAGCAGCAGAAGGCGGG + Intronic
1061506043 9:131032340-131032362 CAGGGGACCCGGCAGGAGGTGGG - Intronic
1061873783 9:133534200-133534222 CAGGGGCCTAAGCAGGTGGAGGG - Intronic
1061882113 9:133573774-133573796 CAGGGGCCTGGGCAGGGGGCGGG - Intronic
1061940967 9:133883597-133883619 CAGGCGGCCCAGCAGCAGGCAGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062095596 9:134701634-134701656 CAGGAGCCTCAGCACGAGGCTGG - Intronic
1062175973 9:135163084-135163106 CAAAGGTCTCACCAGGAAGCAGG - Intergenic
1062319672 9:135984632-135984654 AAGGGGCCTCAGAAGGAGCCTGG - Intergenic
1062394180 9:136346090-136346112 CAGGGGCCTGAGCAGGACACTGG - Intronic
1062397648 9:136358842-136358864 CAGGGGCCTCGACAGGAGCCGGG + Exonic
1062423223 9:136494029-136494051 CAGGGAGCTCTGCAGCAGGCAGG - Intergenic
1062502612 9:136857856-136857878 CAGTGGCCTCAGCACAAGGCTGG - Intronic
1062657864 9:137613500-137613522 CTGGGCTCTCACCAGGAAGCAGG - Exonic
1185503185 X:614339-614361 CAGGGGTCCCAGGTGGGGGCAGG - Intergenic
1185674159 X:1835331-1835353 CAAGGGTCTCTGCAGCAGACAGG + Intergenic
1185894085 X:3843235-3843257 CAGGGCCCTCCCCAGGAGGCGGG + Intronic
1185899203 X:3881659-3881681 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1185904320 X:3920088-3920110 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1190176352 X:48153829-48153851 CAGTGGTCTCTGCTGGAGACAGG - Intergenic
1190212577 X:48459954-48459976 CAGGGATCTCAGCCAGAGGGTGG - Intronic
1194788080 X:98111517-98111539 CAGGGGTTTTAGCAAGAGGGAGG - Intergenic
1194810246 X:98380257-98380279 CAGGGTGCCCAGCAGCAGGCTGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1195294659 X:103464226-103464248 CAGGGGACTCAGCAGCGGGCAGG - Intergenic
1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG + Intergenic
1196391228 X:115209694-115209716 CAGAGGGCTCAGAAGAAGGCAGG + Intronic
1198267318 X:135021913-135021935 CAGGGGCGGCAGCAGGAGCCTGG + Exonic
1198268570 X:135032908-135032930 CAGGGGCGGCAGCAGGAGCCTGG - Exonic
1198536732 X:137594106-137594128 TAGTGGTGTCTGCAGGAGGCTGG + Intergenic
1199982753 X:152929776-152929798 CAGGGCTTTCTGCAGGGGGCTGG - Intronic
1200155808 X:153974369-153974391 CTGGTGTCTCAGCTGGAGTCAGG + Intronic
1200247699 X:154534735-154534757 CCGGGGACCCAGCATGAGGCAGG - Intronic